📑 Procurement Notice (NIT)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
REQUEST FOR BIDS
PROCUREMENT OF GOODS
- The National Institutes of Health (NIH) (National Institutes of Health (NIH)) has reserved Funds for the procurement planned for FY 2026-27. The National Institutes of Health (NIH) (National Institutes of Health (NIH)) intends to apply part of the proceeds of this Fund to cover eligible payments under the contract for the "TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH" with the reference of "P100384"
- The National Institutes of Health (NIH) (National Institutes of Health (NIH)) invites sealed Bids from eligible Bidders for procurement of goods described in the bidding documents on EPADS v2.0.
- Single Stage-One Envelope will be used by adopting Least Cost Based Selection (LCBS) Technique for the subject procurement, in line with the Public Procurement Rules, 2004 and any Regulations, Regulatory Guides, Procurement Guidelines or Instructions issued by the Authority from time to time.
- All Bids must be accompanied by a Bid Security amounting described in Bid Security Section in Bidding Document in the form of Pay Order, Call at Deposit, Demand Draft or all bids must be accompanied by bid securing declaration in the format specified in the Bidding documents
- E-Bidding documents, containing detailed terms & conditions, specifications and requirements etc. are available on e-Pak Acquisition and Disposal System (EPADS) at https://epads.gov.pk/opportunities/federal/procurements/100384 for all the interested bidders registered on EPADS v2.0. Bidders are required to get themselves registered on EPADS v2.0 to participate in Bidding process.
- The e-bids, prepared in accordance with the instructions in the e-Bidding Documents, must be submitted through EPADS v2.0 on or before Wednesday, October 14, 2026 11:00 AM. E-bids will be opened using EPADS v2.0 on the same day at Wednesday, October 14, 2026 11:30 AM. Manual submission of Bids shall not be entertained. Those vendors who have not yet registered on the new version of EPADS v2.0, may register themselves on https://vendors.epads.gov.pk/. A tutorial to explain the registration process is available at https://www.youtube.com/watch?v=MNW6T38v7tc
In terms of Rule 48 of Public Procurement Rules, 2004 Grievance Redressal Committee (GRC) is notified for the subject procurement and notification copy is available on the procuring agency’s website and on Authority’s website at (www.ppra.org.pk).
National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director
Park Road, Islamabad Capital Territory
+92-333-855-4884
purchaseprocurement58@gmail.com
📑 Instructions to Bidders (ITB)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
A. Introduction
1.Scope of Bids
1.1 The Procuring Agency (PA), as indicated in the Bids Data Sheet (BDS) invites Bids through EPADS v2.0 for the provision of Goods for as specified in the BDS and in Section V – Evaluation Criteria, Specifications & Schedule of Requirements. The name, identification, and number of items/deliverables are provided in the BDS. The successful Bidders will be expected to provide the goods within the specified period and timeline(s) as stated in the BDS.
2. Source of Funds
2.1 Source of funds is referred in Clause-1 of Invitation for Bids.
3. Eligible Bidders
3.1 A Bidder may be natural person, company or firm or public or semi-public agency of Pakistan or any foreign country, or any combination of them with a formal existing agreement (on Judicial Papers) in the form of a joint venture, consortium, or association. In the case of a joint venture, consortium, or association, all members shall be jointly and severally liable for the execution of the Contract in accordance with the terms and conditions of the Contract. The joint venture, consortium, or association shall nominate a Lead Member as nominated in the BDS, who shall have the authority to conduct all business for and on behalf of any and all the members of the joint venture, consortium, or association during the Bidding process, and in case of award of contract, during the execution of the contract.
3.2 Verifiable copy of the agreement that forms a joint venture, consortium or association shall be required to be submitted as part of the Bid.
3.3 The appointment of Lead Member in the joint venture, consortium, or association shall be confirmed by submission of a valid Power of Attorney to the Procuring Agency.
3.4 Any bid submitted by the joint venture, consortium or association shall indicate the part of proposed contract to be performed by each party and each party shall be evaluated (or post qualified if required) with respect to its contribution only, and the responsibilities of each party shall not be substantially altered without prior written approval of the Procuring Agency and in line with any instructions issued by the Authority.
(The limit on the number of members of JV or Consortium or Association may be prescribed in BDS, in accordance with the guidelines issued by the PPRA).
3.5 The invitation for Bids is open to all prospective suppliers, manufacturers, or authorized agents / dealers subject to any provisions of incorporation or licensing by the respective national incorporating agency or statutory body established for that particular trade or business. Procuring agencies shall specify the registration/licensing requirements for the foreign bidders keeping in view the requirement of that business.
3.6 A Bidder shall not have a conflict of interest. All Bidders found to have a conflict of interest shall be disqualified. A Bidder may be considered to have a conflict of interest with one or more parties in this Bidding process, if they:
- are associated or have been associated in the past, directly or indirectly with a firm or any of its affiliates which have been engaged by the Procuring Agency to provide consulting services for the preparation of the design, specifications and other documents to be used for the procurement of the Goods to be purchased under this Invitation for Bids.
- have controlling shareholders in common; or
- receive or have received any direct or indirect subsidy from any of them; or
- have the same legal representative for purposes of this Bid; or
- have a relationship with each other, directly or through common third parties, that puts them in a position to have access to information about or influence on the Bids of another Bidder, or influence the decisions of the Procuring Agency regarding this Bidding process; or
- Submit more than one Bid in this Bidding process.
3.7 A Bidder may be ineligible if –
- he is declared bankrupt or, in the case of company or firm, insolvent;
- payments in favor of the Bidder is suspended in accordance with the judgment of a court of law other than a judgment declaring bankruptcy and resulting (in accordance with the national laws) in the total or partial loss of the right to administer and dispose of its property;
- the Bidder is convicted, by a final judgment, of any offence involving professional conduct;
- the Bidder is blacklisted locally or by international organizations and hence debarred due to involvement in corrupt and fraudulent practices, or performance failure or due to breach of Bid securing declaration.
3.8 As and when required, bidders shall provide to the Procuring Agency evidence of their eligibility, proof of compliance with the necessary legal requirements to carry out the contract effectively.
3.9 Bidders shall submit Bids relating to the nature, conditions and modalities of sub-contracting wherever the sub-contracting of any elements of the contract amounting to more than ten (10) percent of the Bid price is envisaged.
4. Eligible Goods and Related Services
4.1 All goods and related services to be supplied under the contract shall have their origin in eligible source countries, and all expenditures made under the contract will be limited to such goods and services. For purpose of this Bid, ineligible countries are the countries declared ineligible by the Federal Government.
5. One Bid per Bidder
5.1 A bidder shall submit only one Bid, in the same bidding process, either individually as a Bidder or as a member in a joint venture or any similar arrangement.
5.2 The Bidder shall not engage a subcontractor for any portion of the contract if the value of such subcontracting exceeds thirty percent (30%) of the total contract amount.
6. Cost of Bidding
6.1 Any cost incurred by the bidder relating to the preparation and submission of its Bid shall be borne by the bidder, and the Procuring Agency shall in no case be responsible or liable for those costs, regardless of the conduct or outcome of the bidding process.
B. Bidding Documents
7. Contents of Bidding Document
7.1 The Goods required, Bidding procedures, and terms and conditions of the contract are prescribed in the Bidding Documents. In addition to the Invitation for Bids, the Bidding documents which should be read in conjunction with any addenda issued in accordance with ITB 9.1 include:
Section I -Invitation to Bids
Section II Instructions to Bidders (ITB)
Section III Bid Data Sheet (BDS)
Section IV Evaluation Criteria, Specifications, Schedule of Requirements
Section V Bid Forms
Section VI General Conditions of Contract (GCC)
Section VII Special Conditions of Contract (SCC)
Section VIII Contract Forms
7.2 The Bidder is expected to examine all instructions, forms, terms and specifications in the Bidding documents. Failure to furnish all the information required in the Bidding documents through EPADS v2.0 will be at the Bidder’s risk and may result in the rejection of his Bids.
8. Clarification of Bidding documents
8.1 A prospective Bidder requiring any clarification of the Bidding documents may notify the Procuring Agency through EPADS v2.0.
8.2 The Procuring Agency will within three (3) working days after receiving the request for clarification, respond to any request for clarification through EPADS v2.0 provided that such request is received not later than three (03) days prior to the deadline for the submission of Bids as prescribed in ITB 22
8.3 Copies of the Procuring Agency's response will be forwarded to all identified Prospective Bidders through EPADS v2.0, including a description of the inquiry, but without identifying its source.
8.4 Should the Procuring Agency deem it necessary to amend the Bidding document as a result of a clarification, it shall do so following the procedure under ITB 9.
8.5 If indicated in the BDS, the Bidder’s designated representative is invited at the Bidder’s cost to attend a pre-Bid meeting at the place, date and time mentioned in the BDS. During this pre-Bid meeting, prospective Bidders may request clarification of the schedule of requirement, the Evaluation Criteria or any other aspects of the Bidding document.
8.6 Minutes of the pre-Bid meeting, if applicable, including the text of the questions asked by Bidders, including those during the meeting (without identifying the source) and the responses given, together with any responses prepared after the meeting will be uploaded on EPADS v2.0. Any modification to the Bidding documents that may become necessary as a result of the pre-Bid meeting shall be made by the Procuring Agency exclusively through the use of an Addendum pursuant to ITB 9. Non-attendance at the pre-Bid meeting will not be a cause for disqualification of a Bidder.
9. Amendment of Bidding documents
9.1 Before the deadline for submission of Bids, the Procuring Agency for any reason, whether at its own initiative or in response to a clarification requested by a prospective Bidder or Pre-Bid meeting may modify the Bidding documents by issuing addenda through EPADS v2.0.
9.2 The Procuring Agency shall promptly publish the addendum through EPADS v2.0.
9.3 Any addendum issued including the notice of any extension of the deadline shall also be communicated through EPADS v2.0 to all the bidders who have already submitted their bids. Such bidders shall have the right to withdraw their already submitted bid and re-submit the revised bid prior to the original or extended bid submission deadline.
9.4 To give prospective Bidders reasonable time in which to take an addendum/corrigendum into account in preparing their Bids, the Procuring Agency may, at its discretion, extend the deadline for the submission of Bids through EPADS v2.0:
Provided that the Procuring Agency shall extend the deadline for submission of Bids, if such an addendum is issued within last three (03) days of the Bids submission deadline.
C. Preparation of Bids
10. Language of Bid
10.1 The Bid prepared by the bidder, as well as all correspondence and documents relating to the Bids exchanged by the Bidder and the Procuring Agency shall be written in the English language unless otherwise specified in the BDS. Supporting documents and printed literature furnished by the Bidder may be in another language provided they are accompanied by an accurate translation of the relevant pages in the English language unless otherwise specified in the BDS, in which case, for purposes of interpretation of the Bidder, the translation shall govern.
11. Documents and samples Constituting the Bid
11.1 The Bid prepared by the Bidder shall constitute thedocuments required in the BDS.
Details of sample(s) where applicable and requested in the BDS.
1. Documentary evidence established in accordance with ITB that the Bidder is eligible and/or qualified for the subject bidding process;
2. Documentary evidence establish that the Bidder has been authorized by the manufacturer to deliver the goods into Pakistan, where required and where the supplier is not the manufacturer of those goods;
3. Documentary evidence establish that the goods and related services to be supplied by the Bidder are eligible goods and services, and conform to the Bidding Documents;
4. Bid security or Bid Securing Declaration furnished in accordance with ITB 18.
12. Documents Establishing Eligibility of the Goods and Conformity to Bidding documents
12.1 To establish the conformity of the bidder to the Bidding document, the Bidder shall furnish as part of its Bids the documentary evidence that Goods provided conform to the technical specifications and standards.
13. Documents Establishing Eligibility and Qualification of the Bidder
13.1 The Bidder shall furnish, as part of itsBid, all those documents establishing the Bidder’s eligibility to participate in the Bidding process and/or its qualification to perform the contract if its Bid is accepted.
14. Form of Bids
14.1 The Bidder shall fill the Form of Bid furnished in the Bidding documents.The Bids Form must be completed without any alterations to its format and no substitute shall be accepted.
15. Bids Prices
15.1 The Bids Prices quoted by the Bidder in the Form of Bid and in the Price Schedules shall conform to the requirements specified below or exclusively mentioned hereafter in the Bidding documents.
15.2 All items in the Schedule of Requirement must be listed and priced separately in the Price Schedule(s). If a Price Schedule shows items listed but not priced and neither explicitly denied, their prices shall be construed to be included in the prices of other items.
15.3 Items not listed in the Price Schedule shall be assumed not to be included in the Bid, and provided that the Bid is still substantially responsive in their absence or due to their nominal nature, the corresponding average price of the respective item(s) of the remaining substantially responsive Bidder(s) shall be construed to be the price of those missing item(s)
15.4 The Bid price to be quoted in the Form of Bid in accordance with ITB 14.1 shall be the total price of the Bid.
15.5 The Bidder shall indicate on the appropriate Price Schedule, the unit prices (where applicable) and total Bid price of the Goods it proposes to provide under the contract.
15.6 Prices quoted by the Bidder shall be fixed during the Bidder’s performance of the contract and not subject to variation on any account. A Bid submitted with an adjustable price will be treated as non-responsive and shall be rejected.
16. Bids Currencies
16.1 Prices shall be quoted in Pakistani Rupees unless otherwise specified in the BDS in accordance with Rule 30 (2) of the Public Procurement Rules, 2004.
17. Bids Validity Period
17.1 Bids shall remain valid for the period specified in the BDS after the Bid submission deadline prescribed by the Procuring Agency. A Bid valid for a shorter period shall be rejected by the Procuring Agency as non-responsive. The period of Bid validity will be determined from the complementary Bid securing instrument, i.e. the expiry period of Bid Security or Bids Securing Declaration as the case may be.
17.2 The procuring agency shall ordinarily be under an obligation to process and evaluate the bid and to issue letter of award within the stipulated bid validity period.
17.3 Under exceptional circumstances, prior to the expiration of the initial Bid validity period, the Procuring Agency may request the Bidders’ consent to an extension of the period of validity of their Bids only once through EPADS v2.0, for the period not more than the period of initial bid validity. The Bid Security provided under ITB 18 shall also be suitably extended. A Bidder may refuse the request without forfeiting its Bid security or causing to be executed its Bid Securing Declaration. A Bidder agreeing to the request will not be required nor permitted to modify its Bid, but will be required to extend the validity of its Bid Security or Bid Securing Declaration for the period of the extension.
18. Bid Security or Bid Securing Declaration
18.1 The Bidder shall furnish as part of its Bid, a Bid Security in accordance with Rule 25 of the Public Procurement Rules, 2004.
18.2 The original Bid Security shall be enclosed within the sealed envelope and to be submitted physically before closing time for submission of bids. Whereas, scanned copy of bid security shall be uploaded electronically through EPADS v2.0 before closing hours for submission of bids.
18.3 The Bidder who failed to submit the original Bids security before the submission deadline shall be disqualified straightaway.
18.4 The Bid Security or Bid Securing Declaration is required to protect the Procuring Agency against the risk of Bidder’s conduct which would warrant the security’s forfeiture, pursuant to ITB 18.7.
18.5 The Bid Security shall be denominated in the local currency, and it shall be a Bank Draft in the name of the Procuring Agency and valid for twenty-eight (28) days beyond the end of the validity of the Bid. This shall also apply if the period for Bids/Bid Validity is extended. In either case, the form must include the complete name of the Bidder.
18.6 The Bid Security shall be payable promptly upon written demand by the Procuring Agency in case any of the conditions listed in ITB 18 are invoked.
18.7 Unsuccessful Bidders’ Bid Security will be discharged or returned as promptly as possible, however in no case later than thirty (30) days after the expiration of the period of Bids Validity prescribed by the Procuring Agency pursuant to ITB 17. The Procuring Agency shall make no claim to the amount of the Bid Security, and shall promptly return the Bid Security document, after whichever of the following that occurs earliest:
- the expiry of the Bid Security;
- the entry into force of a procurement contract and the provision of a Performance Guarantee, for the performance of the contract if such a guarantee, is required by the Bid documents;
- the rejection by the Procuring Agency of all Bids;
- the withdrawal of the Bids prior to the deadline for the submission of Bids, unless the Bids documents stipulate that no such withdrawal is permitted.
18.8 The successful Bidder’s Bids Security will be discharged upon the Bidder signing the contract, or furnishing the Performance Guarantee.
18.9 The Bid Security may be forfeited or the Bid Securing Declaration executed:
- if a Bidder:
- withdraws its Bid during the period of Bid Validity as specified by the Procuring Agency, and referred by the Bidder on the Form of Bids except as provided for in ITB 17.2; or
- does not accept the correction of errors; or
- in the case of a successful Bidder, if the Bidder fails:
- to sign the contract; or
- to furnish Performance Guarantee.
19. Withdrawal, Substitution, and Modification of Bid
19.1 Before Bid submission deadline, any Bidder may withdraw, substitute, or modify its Bid after it has been submitted through EPADS v2.0. Bids requested to be withdrawn, shall be returned unopened to the Bidders through EPADS v2.0.
20. Format and Signing of Bid
20.1 The Bidder shall prepare and submit Bids with due diligence after carefully reading all the terms and condition before bid submission deadline through EPADS v2.0.
D. Submission of Bids
21. Submission of Bids through EPADS v2.0
21.1 The Technical and Financial Bids if required to submitted, shall be submitted on EPADS v2.0.
22. Deadline for Submission of Bids
22.1 Bids shall be received by the Procuring Agency through EPADS v2.0 before bid submission deadline.
22.2 The Procuring Agency may, under exceptional circumstances, extend the deadline for the submission of Bids, after recording reasons in writing and in an equal opportunity manner.
In such case, all rights and obligations of the Procuring Agency and the Bidders that were previously governed by the original deadline shall thereafter be subject to the revised deadline.
E. Opening and Evaluation of Bids
23. Opening of Bids
23.1 The Bid Evaluation Committee of the Procuring Agency shall open all Bids through the EPADS v2.0, on the date and time specified in the Bid Data Sheet (BDS).
23.2 The Bid Evaluation Committee shall generate minutes through EPADS v2.0 containing brief details of bid opening process. The record of the Bid opening shall include, as a minimum: the name of the Bidder, the Bid price if applicable, and the presence or absence of a Bid Security or Bid Securing Declaration.
23.3 The procuring agency shall live broadcast the opening of bids on national media or on their website or digital channels, if the volume of procurement exceeds five hundred million rupees in case of goods and services and one thousand million rupees in case of works.
23.4 In case the date of opening of bid has been declared as public holiday or the procuring agency fail to open bid due to any EPADS v2.0 related issues, the submission and opening of bids shall be shifted to the next working day on the same time.
23.5 In case of Single Stage One Envelope Procedure, the Bidders names, the Bid prices, the total amount of each Bid and, the presence or absence of Bid Security, Bid Securing Declaration and such other details as the Procuring Agency may consider appropriate, will be announced by the Bid Evaluation Committee.
24. Clarification of Bids
24.1 To assist in the examination, evaluation and comparison of Bids of the Bidders, the Procuring Agency may, ask any Bidder for a clarification of its Bid including breakdown of prices.
24.2 The request for clarification and the response shall be sought through EPADS v2.0 before three days prior to the deadline for submission of bids. No change in the prices or substance of the Bids shall be sought, offered, or permitted.
24.3 The alteration or modification in the BIDS which in any way affect the following parameters will be considered as a change in the substance of a Bids:
- evaluation & qualification criteria;
- required scope of work or specifications;
- all securities requirements;
- tax requirements;
- terms and conditions of Bidding documents.
- change in the ranking of the Bidder
24.4 From the time of Bids opening to the time of Contract award if any Bidder wishes to contact the Procuring Agency on any matter related to the Bids it should do so through EPADS v2.0.
25. Preliminary Examination of Bids
25.1 Prior to the detailed evaluation of Bids, the Procuring Agency will determine whether each Bid:
- meets the eligibility criteria defined in ITB 3;
- has been prepared as per the format and contents defined by the Procuring Agency in the Bidding documents;
- is accompanied by the required securities; and
- is substantially responsive to the requirements of the Bidding documents.
25.2 The Procuring Agency's determination of a Bid's responsiveness will be based on the contents of the Bid itself.
25.3 A substantially responsive Bid is one which conforms to all the terms, conditions, and specifications of the Bidding documents, without material deviation or reservation. A material deviation or reservation is one that: -
- affects in any substantial way the scope, quality, or performance of the Goods;
- limits in any substantial way, inconsistent with the Bidding documents, the Procuring Agency's rights or the Bidders obligations under the Contract; or
- if rectified, would affect unfairly the competitive position of other Bidders presenting substantially responsive Bids.
25.3 If a Bids is not substantially responsive, it will be rejected by the Procuring Agency and may not subsequently be evaluated for complete technical responsiveness.
26. Examination of Terms and Conditions; Technical Evaluation
26.1 The Procuring Agency shall examine the Bids to confirm that all terms and conditions specified in the GCC and the SCC have been accepted by the Bidder without any material deviation or reservation.
26.2 The Procuring Agency shall evaluate the technical aspects of the Bids submitted, to confirm that all requirements specified in Schedule of Requirements and Technical Specifications of the Bidding documents have been met without material deviation or reservation.
26.3 If after the examination of the terms and conditions and the technical evaluation, the Procuring Agency determines that the Bid is not substantially responsive in accordance with ITB 25.2, it shall reject the Bid.
27. Correction of Errors
27.1 Bids determined to be substantially responsive will be checked for any arithmetic errors. Errors will be corrected as follows: -
- if there is a discrepancy between unit prices and the total price that is obtained by multiplying the unit price and quantity, the unit price shall prevail, and the total price shall be corrected, unless in the opinion of the Procuring Agency there is an obvious misplacement of the decimal point in the unit price, in which the total price as quoted shall govern and the unit price shall be corrected;
- if there is an error in a total corresponding to the addition or subtraction of sub-totals, the sub-totals shall prevail and the total shall be corrected; and
- where there is a discrepancy between the amounts in figures and in words, the amount in words will govern.
- Where there is discrepancy between grand total of price schedule and amount mentioned on the Form of Bids, the amount referred in Price Schedule shall be treated as correct subject to elimination of other errors.
27.2 The amount stated in the Bid will, be adjusted by the Procuring Agency in accordance with the above procedure for the correction of errors and, with the concurrence of the Bidder, shall be considered as binding upon the Bidder. If the Bidder does not accept the corrected amount, its Bid will then be rejected, and the Bid Security may be forfeited or the Bids Securing Declaration may be executed.
28. Conversion to Single Currency
28.1 To facilitate evaluation and comparison, the Procuring Agency will convert all Bids prices expressed in the amounts in various currencies in which the Bids prices are payable. For the purposes of comparison of bids quoted in different currencies, the price shall be converted into a single currency specified in the bidding documents. The rate of exchange shall be the selling rate prevailing on the date of opening of financial bids specified in the bidding documents, in accordance with weighted average customer exchange rates list issued by the State Bank of Pakistan on that day.
29. Evaluation of Bids
29.1 The Bids, quotations, or proposals shall be evaluated by the respective evaluation committees as per evaluation criteria described in the Bidding Documents in accordance with Rule 29 and 30 of the Public Procurement Rules, 2004.
1. Least Cost Based Selection (LCBS)
After meeting the requirements of eligibility, qualification and substantial responsiveness, the bid in compliance with all the mandatory (technical) specifications/requirements and/or requisite quality threshold (if any), and having lowest evaluated cost (or financial proposal) shall be considered Successful Bid.
2. Quality and Cost Based Selection (QCBS)
In such combination, there shall be some specific weightage of both the technical features and financial aspects of the proposal. The financial marks shall be awarded on the basis of inverse proportion calculations. The successful bid shall be declared, on the basis of combined evaluation.
3. Quality Based Selection (QBS)
Atter meeting the requirements of eligibility, qualification and substantial responsiveness the bid in compliance with all the mandatory (technical) specifications/requirements and attaining highest marks in the Technical Evaluation considering all other qualitative and/or quantitative parameters (or point rated criteria) for technical proposal(s) such as working methodology, implementation plan, resource allocation, additional functionalities, risk management approach, knowledge transfer techniques, post implementation methodology etc. shall be treated as highest ranked bid. Later on, the financial proposal of highest ranked bidder shall be opened, however, in case of failure to proceed further with such a bidder, the procuring agency may resort to second highest bidder and so on.
29.2 In case of tie of bids, the bidders shall be provided an opportunity to offer their best and final monetary offer through EPADS v2.0. However, in no case the rates shall be higher than the original financial bids.
30. Domestic Preference
30.1 The procuring agency shall evaluate and compare bids, allow for preference to domestic bidders, while competing with the international bidders in accordance with the policies of Federal Government.
The percentage of preference, to be accorded shall be clearly mentioned in the bidding documents under the bid evaluation criteria.
31. Determination of Successful Bid
31.1 Selection technique will be adopted for determining the Successful Bid in accordance with the criteria referred in the BDS or prescribed in the separate section titled as Evaluation Criteria.
31.2 In case where the Procuring Agency adopts the Cost Based Evaluation Technique and, the Bid with the lowest evaluated price from amongst those which are eligible, compliant and substantially responsive shall be the Successful Bid.
31.3 The Procuring Agency may adopt the Quality & Cost Based Selection Technique due to the following two reasons:
1. Where the Procuring Agency knows about the main features, usage and output of the products; however not clear about the complete features, technical specifications and functionalities of the goods to be procured and requires the bidders to submit their proposals defining those features, specifications and functionalities; or
2. Where the Procuring Agency, in addition to the mandatory requirements and mandatory technical specifications, requires parameters specified in Evaluation Criteria to be evaluated while determining the quality of the goods.
31.4 In such cases, the Procuring Agency may allocate certain weightage to these factors as a part of Evaluation Criteria, and may determine the ranking of the bidders on the basis of combined evaluation in accordance with provisions of Rule 2(1)(h) of the Public Procurement Rules, 2004.
32. Abnormally Low Financial Bids
32.1Where the Bid price is considered to be abnormally low, the Procuring Agency shall perform price analysis either during determination of Successful Bids or as a part of the post-qualification process.
32.2 The Procuring Agency may reject an Abnormally low financial bids.
32.3 In order to identify the Abnormally Low Bids (ALB) following approaches can be considered to minimize the scope of subjectivity:
- Comparing the Bids price with the cost estimate;
- Comparing the Bids price with the Bids offered by other Bidders submitting substantially responsive Bids; and
- Comparing the Bids price with prices paid in similar contracts in the recent past either government- or development partner-funded.
32.4 The Procuring Agency will determine to its satisfaction whether the Bidder that is selected as having submitted the successful bid is qualified to perform the contract satisfactorily.
32.5 The determination will take into account the Bidder’s financial, technical, and production capabilities. It will be based upon an examination of the documentary evidence of the Bidder’s qualifications submitted by the Bidder, as well as such other information as the Procuring Agency deems necessary and appropriate. Factors not included in these Bidding documents shall not be used in the evaluation of the Bidders’ qualifications.
32.6 Procuring Agency may seek “Certificate for Independent Price Determination” from the Bidder and the results of reference checks may be used in determining an award of contract.
Explanation: The Certificate shall be furnished by the Bidder. The Bidder shall certify that the price is determined keeping in view of all the essential aspects such as raw material, its processing, value addition, optimization of resources due to economy of scale, transportation, insurance and margin of profit etc.
32.7 An affirmative determination will be a prerequisite for award of the contract to the Bidder. A negative determination will result in rejection of the Bidder’s Bids, in which event the Procuring Agency will proceed to the next ranked Bidder to make a similar determination of that Bidder’s capabilities to perform satisfactorily.
F. Award of Contract
33. Criteria of Award
33.1 The Procuring Agency will award the Contract to the Bidder whose Bids has been determined to be substantially responsive to the Bidding documents and who has been declared as Most Advantageous Bidder.
34. Negotiations
34.1 The procuring agency shall not engage in negotiations with respect to scope and price with the bidder except when the procuring agency conducts a procurement using direct or negotiated contracting or a request for proposals with evaluation based on quality alone.
34.2 The procuring agency may negotiate with the most advantageous bid with a view to streamline the work or task execution, at the time of contract finalization on methodology, work plan, staffing, finalizing payment arrangements, delivery arrangements, minor amendments to the special conditions of the contract.
35. Procuring Agency Right to reject all bids
35.1 The Procuring Agency reserves the right to reject all bids or proposals at any time prior to the issuance of the Letter of Award, without incurring any liability, in accordance with Rule 33 of the Public Procurement Rules, 2004.
36. Procuring Agency’s Right to Vary Quantities at the Time of Award
36.1 The Procuring Agency reserves the right at the time of contract award to increase or decrease the quantity of Goods originally specified in these Bidding documents provided this does not exceed by 15%, without any change in unit price or other terms and conditions of the Bids and Bidding documents.
37. Notification of Award
37.1 Prior to the award of contract, the procuring agency shall announce and publish the result of bid evaluation on EPADS v2.0 in accordance with Rule 35 of the Public Procurement Rules, 2004.
37.2 The Bidder whose Bids has been accepted will be notified of the award by the Procuring Agency prior to expiration of the Bids/Bid Validity period. The Letter of Award will state the sum that the Procuring Agency will pay the successful Bidder in consideration for the delivery of Goods as prescribed by the Contract (hereinafter and in the Contract called the "Contract Price).
37.3 The Letter of award will constitute the formation of the Contract, subject to the Bidder furnishing the Performance Guarantee and signing of the contract.
38. Signing of Contract
38.1 Promptly after issuance of Letter of award, Procuring Agency shall send the successful Bidder the draft Contract, incorporating all terms and conditions as agreed by the parties to the contract.
38.2 Immediately after the Redressal of grievance by the GRC (if any), mandatory standstill period in accordance with Rule 35 of the Public Procurement Rules, 2004 and after fulfillment of all condition’s precedent of the Contract Form, the successful Bidder and the Procuring Agency shall sign the Contract.
39. Corrupt & Fraudulent Practices
39.1 Procuring Agencies (including beneficiaries of Government funded projects and procurement) as well as Bidders/Contractors under Government financed contracts, observe the highest standard of ethics during the procurement and execution of such contracts, and will avoid to engage in any corrupt and fraudulent practices.
F. Grievance Redressal & Complaint Review Mechanism
40. Constitution of Grievance Redressal
40.1 The Grievance Redressal Committee shall address the grievance, if any submitted by any party, including the bidder, in accordance with Rule 48 of the Public Procurement Rules, 2004 to be read with Redressal of Grievances Regulations, 2021.
40.2 In case if any party or the bidder is not satisfied with the decision of the GRC or if it fails to decide within ten days, the bidder or the party may file an appeal before the Appellate Committee of the Authority in accordance with Rule 48 of the Public Procurement Rules, 2004 to be read with Redressal of Grievances Regulations, 2021.
G. Mechanism of Blacklisting
41. Mechanism of Blacklisting
41.1 The Procuring Agency shall initiate blacklisting proceedings against any bidder, supplier, or contractor in accordance with the Mechanism for Blacklisting Regulations, 2024, read with Rule 19 of the Public Procurement Rules, 2004.
41.2 The blacklisted/debarred bidder may file the review petition before the Authority in accordance with Rule 19 of the Public Procurement Rules, 2004 to be read with Procedure of filing and disposal of Review Petitions Regulations, 2021.
📑 Bid Data Sheet (BDS)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
Bids Data Sheet (BDS)
The following specific data for the procurement of Goods to be procured shall complement, supplement, or amend the provisions in the Instructions to Bidders (ITB). Whenever there is a conflict, the provisions herein shall prevail over those in ITB.
BDS Clause Number
ITB Number
Amendments of, and Supplements to, Clauses in the Instruction to Bidders
A. Introduction
BDS Clause Number 1
ITB Number 1.1
Name of Procuring Agency: National Institutes of Health (NIH) (National Institutes of Health (NIH))
The subject of procurement is: TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Expected commencement date: Monday, November 30, 2026
BDS Clause Number 2
ITB Number 2.1
Financial year for the operations of the Procuring Agency: 2026-27
Name and identification number of the Contract: P100384
BDS Clause Number 3
ITB Clause Number 3.1
JV/Consortium or Association Allowed: No
Number of JV/Consortium Members: Nil
see section of eligibility criteria.
B. Bidding Documents
BDS Clause Number 4
ITB Number 8.1
The Bidders may seek clarifications through EPADS v2.0 : Clarification Date: Friday, September 25, 2026
C. Preparation of Bids
BDS Clause Number 5
ITB Number 10.1
The Language of all correspondences and documents related to the Bids shall be in: English
List of documents required along with the bid: No
BDS Clause Number 6
ITB Number 11.1
Items/Lots and threre related documents:
See section items and Lots
BDS Clause Number 7
ITB Number 12.1
Items / Lots Specifications:
see section of items specifications.
BDS Clause Number 8
ITB Number 15.6
The price shall be Fixed.
BDS Clause Number 9
ITB Number 16.1
Currency of the Bids shall be : PKR
BDS Clause Number 10
ITB Number 17.1
The Bids/Bid Validity period shall be: 300 Days
BDS Clause Number 11
ITB Number 18.1
The amount of Bid Security shall be as defined in Bid Security Section for items and lots given in BDS 6
The Bid Security shall be in the form of: Pay Order, Call at Deposit, Demand Draft
D. Submission of Bids
BDS Clause Number 12
ITB Number 20.1
Bid shall be submitted online on EPADS v2.0 whereas hard copy of the bid security should be submitted to the following;
Park Road, Islamabad Capital Territory before bid submission deadline.
Bids that are not submitted on EPADS v2.0 shall be disqualified.
The deadline for Bids submission is: Wednesday, October 14, 2026 11:00 AM
E. Opening and Evaluation of Bids
BDS Clause Number 13
ITB Number 23.1
The Bids opening shall take place on EPADS v2.0.
Day : Wednesday
Date: Wednesday, October 14, 2026
Time : 11:30 AM
BDS Clause Number 14
ITB Number 31.1
Selection technique adopted will be: Least Cost Based Selection (LCBS)
see Evaluation Criteria
F. Review of Procurement Decisions
BDS Clause Number 15
ITB Number 41.1
Grievence against this procurement shall be submitted online on EPADS v2.0.
Arbitrator shall be appointed by mutual consent of the both parties.
Eligibility Criteria
| Bidder's Type | Required Registration |
|---|---|
|
Any |
NADRA CITIZENSHIP (CNIC/NICOP) FBR (NTN) FBR (GSTN) |
| Eligibility Criteria | Document |
|---|---|
| Bank Statement | Yes |
Evaluation Criteria
Eligibile bidder(s) with substantially responsive bid(s) offering Least Cost Based Selection (LCBS) shall be consider for the award of contract(s).
Least Cost Based Selection (LCBS)
Items/Lots
Items Without Lots :
| Item | UNSPSC | Delivery Schedule | Quantity | Bid Security |
|---|---|---|---|---|
| Spirit Rectified, (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.) | Spirits or liquors |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 40/Ltr
|
40/Ltr | 95.02 PKR |
| Chloroform (AR grade), (Merck / BDH/ Equivalent) (Nut. Div.) | Chloroform |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Ltr
|
10/Ltr | 23.74 PKR |
| (AR grade) (Merck /BDH/ equivalent) NH4 OH (Nut. Div.)2.5 ltr | Chemical management service |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Ltr
|
5/Ltr | 29.68 PKR |
| (Merck / BDH/ equipment) (Nut. Div.) | Equipment inspection service |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 25/Ltr
|
25/Ltr | 148.46 PKR |
| (Merck / BDH/ Equivalent (Nut. Div.) | Equipment inspection service |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Ltr
|
5/Ltr | 12 PKR |
| Absolute Ethanol (AR grade) (Nut. Div.) | Benzocaine/chlorobutanol/ethanol/menthol/tannic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 25/Ltr
|
25/Ltr | 1485 PKR |
| Acetic Acid Glacial (AR grade) (Nut. Div.) | Acetic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Ltr
|
2/Ltr | 12 PKR |
| Acetic Acid Glacial (AR grade) Scharlau/ equivalent (Nut. Div.) | Acetic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Ltr
|
10/Ltr | 24 PKR |
| Acetone GC grade (Merck /BDH) (Nut. Div.) | Acetone/alcohol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Ltr
|
2/Ltr | 12 PKR |
| Acetonitrile (Nut. Div.) | Acetonitrile |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| Acidum formicium (Nut. Div.) | 2,3-diphosphoglyceric acid test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/ml
|
500/ml | 1188 PKR |
| Agra Strip Pro (Total Aflatoxin) Romer Lab (Nut. Div.) | Binding combs or strips |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Alkalinity HANNA Instrument (Nut. Div.) | Alkaline phosphatase or isoenzymes test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Aluminum HANNA Instrument (Nut. Div.) | Acetaminophen/aluminum acetate/chlorpheniramine/phenylpropanolam |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Aluminum oxid (Nut. Div.) | Aluminum oxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 1188 PKR |
| Ammonia HR HANNA Instrument (Nut. Div.) | Ammonia |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Ammonium Chloride (Merck / BDH) (Nut. Div.) | Aminophylline/ammonium chloride/diphenhydramine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Ammonium Hydroxide (conc) (Nut. Div.) | Ammonium hydroxide titrants |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Ammonium molybdate (Merck /BDH) (Nut. Div.) | Aminophylline/ammonium chloride/diphenhydramine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Amyl alcohol (Nut. Div.)2.5ltr | Acetone/alcohol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Qty
|
10/Qty | 59 PKR |
| Anhydrous Sodium Fluoride (Nut. Div.) | Calcium carbonate/sodium fluoride |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Kg
|
5/Kg | 12 PKR |
| Antifoam tablets (Nut. Div.) | Anti foaming agents |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1200/Qty
|
1200/Qty | 2851 PKR |
| Arsenic Test Supelco Kit (Nut. Div.) | Arsenic test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Ascorbic Acid (AR grade) (Nut. Div.) | Ascorbic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Barium Chloride (Merk /BDH) (Nut. Div.) | Barium Ba |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Barium Chloride AR Grade (Merck/ BDH) / equivalent (Nut. Div.) | Barium Ba |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Kg
|
10/Kg | 24 PKR |
| Benzoic acid (Nut. Div.) | 4-aminobenzoic acid or Aminobenzoic acid or PABA or para-aminobenzoic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 12 PKR |
| Boric Acid (AR grade) (Nut. Div.) | Acetone/basic fuchsin/boric acid/resorcinol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Kg
|
3/Kg | 7 PKR |
| Bromine HANNA Instrument (Nut. Div.) | Bromine Br |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Bromocresol green (Nut. Div.) | Bromocriptine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Bromocresol green (Merck /BDH) (Nut. Div.) | Bromocriptine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/g
|
100/g | 238 PKR |
| Bromocresol purple (Merck /BDH) (Nut. Div.) | Bromocriptine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Bromophenol blue (Nut. Div.) | Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Bromothymol Blue (BTB) (Nut. Div.) | Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Calcium carbonate (Nut. Div.) | Acetaminophen/aspirin/calcium carbonate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Calcium Carbonate (Merck/ equivalent) (Nut. Div.) | Acetaminophen/aspirin/calcium carbonate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 12/Kg
|
12/Kg | 29 PKR |
| Calcium Colorimetric assay kits (Nut. Div.) | Calcium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Calcium HANNA Instrument (Nut. Div.) | Calcium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Calcium Marine HANNA Instrument (Nut. Div.) | Calcium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Calcium oxide (Nut. Div.) | Calcium oxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2851 PKR |
| Catalyst tablets for kjeldahl method (Nut. Div.) | Acid catalysts |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1200/Qty
|
1200/Qty | 12 PKR |
| CDTA (Cyclohexylenediaminetetraacetic acid) (Nut. Div.) | Nandrolone cyclohexylpropionate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Kg
|
5/Kg | 1188 PKR |
| Charcoal (Nut. Div.) | Charcoal |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 12 PKR |
| Chlorine Test Kit 6991 LP-DPD Tablets Octet Comparator 0.01 to 1 Ppm and 1.0 to 6.0 Ppm (LA Motte/ Equivalent) (Nut. Div.) | Chlorine Cl |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/gal
|
5/gal | 89 PKR |
| Chloroform (AR grade) (Nut. Div.) | Chloroform |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 15/Qty
|
15/Qty | 2 PKR |
| Choarcoal activated AR grade (Nut. Div.) | Charcoal |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 7 PKR |
| Chromium Vi LR HANNA Instrument (Nut. Div.) | Chromium Cr |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 14 PKR |
| Citric acid (Nut. Div.) | Alcohol/citric acid/salicylic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 6/Qty
|
6/Qty | 6 PKR |
| Citric Acid (Commercial grade) (Nut. Div.) | Alcohol/citric acid/salicylic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Copper acetate (Nut. Div.) | Copper |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 594 PKR |
| Copper acetate(Merck /BDH) (Nut. Div.) | Copper |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 250/g
|
250/g | 7 PKR |
| Copper HR HANNA Instrument (Nut. Div.) | Copper |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 2 PKR |
| Copper sulphate (Nut. Div.) | Copper sulfate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 238 PKR |
| Copper sulphate (Merck /BDH) (Nut. Div.) | Copper sulfate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/g
|
100/g | 1188 PKR |
| Cupric carbonate (Nut. Div.) | Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 2 PKR |
| Cupric sulphate pentahydrate (Merck /BDH) (Nut. Div.) | Chromic chloride/cupric sulfate/manganese sulfate/selenium/zinc |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Di sodium EDTA (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Diethyl ether (Nut. Div.) | Diethyl ether or ether |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 12/Qty
|
12/Qty | 71 PKR |
| Dimethylglyoxim (Nut. Div.) | Didecyldimethylammonium chloride |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 1188 PKR |
| Diphenyl carbazide (Merck /BDH) (Nut. Div.) | Diphenylhydantoin test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 300/g
|
300/g | 713 PKR |
| Diphenylthiocarbazone (Merck /BDH) (Nut. Div.) | Diphenylhydantoin test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/g
|
100/g | 238 PKR |
| Dissolved Oxygen HANNA Instrument (Nut. Div.) | Dissolved oxygen meters |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| EDTA AR Grade (Merck/ equivalent) (Nut. Div.) | Benzalkonium chloride/edta |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Kg
|
10/Kg | 24 PKR |
| Ferric chloride (Nut. Div.) | Ferric chloride colorimetric preparation |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Ferric chloride (Merck /BDH) (Nut. Div.) | Ferric chloride colorimetric preparation |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Ferric citrate (Nut. Div.) | Ferric chloride colorimetric preparation |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 1188 PKR |
| Florisil (Nut. Div.) | Dried cut french florissa tulip |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 453/g
|
453/g | 1076 PKR |
| Flouride Test Kit (Nut. Div.) | Blood bank test kits or supplies |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Fluoride Test Kit (Merck/ equivalent) (Nut. Div.) | Androgeny and fertility test kits and supplies |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| Formaldehyde (Nut. Div.) | Aluminum chlorohydrex/formaldehyde/menthol/zinc undecylenate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 6 PKR |
| Foroglucinol (Merck /BDH) (Nut. Div.) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/g
|
100/g | 238 PKR |
| Glucose (Merck /BDH) (Nut. Div.) | Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Glycerin (AR grade) Scharlau/ equivalent (Nut. Div.) | Acetic acid/antipyrine/benzocaine/glycerin |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Ltr
|
5/Ltr | 12 PKR |
| Hydrochloric Acid (Merck /Eq.) (Nut. Div.) | Hydrochloric acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Ltr
|
5/Ltr | 12 PKR |
| Hydrochloric Acid (conc) (AR grade) (Merck /BDH/ equivalent) (Nut. Div.) | Hydrochloric acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 89 PKR |
| Hydrogen peroxide (Nut. Div.) | Carbamide peroxide or hydrogen peroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Qty
|
10/Qty | 59 PKR |
| Hydrogen peroxide (AR grade) Scharlau/ equivalent (Nut. Div.) | Carbamide peroxide or hydrogen peroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Ltr
|
10/Ltr | 24 PKR |
| Iodine crystals (Merck /BDH) (Nut. Div.) | Calcium/iodine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Iodine HANNA Instrument (Nut. Div.) | Calcium/iodine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Iron HR HANNA Instrument (Nut. Div.) | Iron Fe |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Kaliumdichromate (Nut. Div.) | Chromate standards |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Kaliumjodid reinst (Nut. Div.) | Acid or alkali resistant castable |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Lead chromate (Merck /BDH) (Nut. Div.) | Chromate standards |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1.5/Kg
|
1.5/Kg | 4 PKR |
| Magnesium HANNA Instrument (Nut. Div.) | Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Magnesium Sulfate (Merck/BDH) (Nut. Div.) | Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Magnesium Sulfate Ar Grade (Merck /BDH) / (Nut. Div.) equivalent | Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Kg
|
5/Kg | 12 PKR |
| Magnesium sulfate hepta hydrate (Merck /BDH) (Nut. Div.) | Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Magnesium system reagent Thermoscientific (Nut. Div.) | Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Magnesium Test Kit (Merck/Equivalent) (Nut. Div.) | Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| Manganese HR HANNA Instrument (Nut. Div.) | Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Megnisumnitrat (Nut. Div.) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Methanol (HPLC grade) (Nut. Div.) | Methanol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| Methyl orange indicator (Nut. Div.) | 3-methylmorphine or codeine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1.5/Kg
|
1.5/Kg | 4 PKR |
| Methyl red (Nut. Div.) | 3-methylmorphine or codeine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Methyl Red ( AR grade) (Merck /BDH) (Nut. Div.) | 3-methylmorphine or codeine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1.5/Kg
|
1.5/Kg | 2 PKR |
| Methylene blue (Nut. Div.) | 3,4-methylenedioxyphenyl-2-propanone |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 4 PKR |
| Methylene blue (Merck /BDH) (AR grade) (Nut. Div.) | 3,4-methylenedioxyphenyl-2-propanone |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1.5/Kg
|
1.5/Kg | 2 PKR |
| Natrium hydrogen carbonates (Nut. Div.) | 6-phosphogluconate dehydrogenase test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 25/Kg
|
25/Kg | 4 PKR |
| Natrium oxalate (Nut. Div.) | B-type natriuretic peptide test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 59 PKR |
| n-hexane (HPLC grade) (Nut. Div.) | Nandrolone cyclohexanecarboxylate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 12/Qty
|
12/Qty | 2 PKR |
| Nickel HR HANNA Instrument (Nut. Div.) | Cast coated anisotropic ferrous aluminum nickel cobalt magnet |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 71.26 PKR |
| Nitrate HANNA Instrument (Nut. Div.) | Aminoethyl nitrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Nitrate kit thermoscientific (Nut. Div.) | Aminoethyl nitrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Nitric Acid (AR grade) (Nut. Div.) | The diagnosis of toxic effect of nitroglycerin and nitric acids and esters |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 12/Qty
|
12/Qty | 71 PKR |
| Nitrite HR HANNA Instrument (Nut. Div.) | Amyl nitrite/sodium nitrite/sodium thiosulfate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Nitrium chloride (Nut. Div.) | Calcium/chloride/gluconate/magnesium/potassium/sodium/sulfate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Ozone HANNA Instrument (Nut. Div.) | Ozone analyzers |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Pepsin (Nut. Div.) | Amylase/bile salts/dehydrocholic acid/lipase/pepsin/proteolytic |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Petroleum ether (40-60 oC) (AR grade) (Nut. Div.) | Petroleum or chemical trucking service |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 60/Qty
|
60/Qty | 356 PKR |
| pH Buffer Tablet (10.00 + 0.02) BDH / equivalent (Nut. Div.) | Buffer solutions |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| PH buffer tablet (4.0+0.02) BDH / equivalent (Nut. Div.) | Buffer solutions |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| pH Buffer Tablet (7.00 + 0.02) BDH / equivalent (Nut. Div.) | Buffer solutions |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| Phenolphthalein indicator (Nut. Div.) | Bisacodyl/magnesium citrate/phenolphthalein |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Phenolphthalein indicator (Merck /BDH) (Nut. Div.) | Bisacodyl/magnesium citrate/phenolphthalein |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/g
|
100/g | 238 PKR |
| Pholoroglucinol (Merck /BDH) (Nut. Div.) | Diagnosis of isolated proteinuria with specified morphological lesion, dense deposit disease |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Phosphate HR HANNA Instrument (Nut. Div.) | Acid phosphatase |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Phosphomolybdic Acid (Merck /BDH) (Nut. Div.) | 2,3-diphosphoglyceric acid test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Phosphorus penta Oxide (AR grade) Scharlau/ equivalent (Nut. Div.) | Diagnosis of disorders of phosphorus metabolism and phosphatases |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Kg
|
5/Kg | 12 PKR |
| Ploroglucinol (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.) | Exploration or development system spare parts or accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Kg
|
5/Kg | 12 PKR |
| Potassium Chloride AR grade (Merck/ BDH) / equivalent (Nut. Div.) | Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Kg
|
10/Kg | 24 PKR |
| Potassium Chloride (Merck/ BDH) (Nut. Div.) | Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Kg
|
4/Kg | 10 PKR |
| Potassium Chromate AR Grade (Merck /BDH) / equivalent (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Kg
|
10/Kg | 24 PKR |
| Potassium dichromate (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Potassium ferricyanide (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Potassium ferricyanide (Merck /BDH) (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2.5/Kg
|
2.5/Kg | 6 PKR |
| Potassium HANNA Instrument (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Potassium hydrogen phthalate (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 1188 PKR |
| Potassium Hydroxide (AR grade) Scharlau/ equivalent (Nut. Div.) | Potassium hydroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 7/Kg
|
7/Kg | 17 PKR |
| Potassium Iodide (Scharlau) (Nut. Div.) | Aminophylline/ephedrine/phenobarbital/potassium iodide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1.5/Kg
|
1.5/Kg | 4 PKR |
| Potassium sodium tartrate (Nut. Div.) | Potassium sodium tartrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Resorcinol (Nut. Div.) | Acetone/basic fuchsin/boric acid/resorcinol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Resorcinol (Merck /BDH) (Nut. Div.) | Acetone/basic fuchsin/boric acid/resorcinol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1000/ml
|
1000/ml | 2376 PKR |
| Salicylasure gefallt (Nut. Div.) | Aceclidine salicylate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Silica gel (Nut. Div.) | Silica gel |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Silver nitrate AR Grade (Merck/ equivalent) (Nut. Div.) | Silver nitrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 7/Kg
|
7/Kg | 17 PKR |
| Sodium acetate (Merck /BDH) (Nut. Div.) | Sodium acetate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Sodium benzoate (Nut. Div.) | Caffeine/sodium benzoate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 1188 PKR |
| Sodium bicarbonate (Merck /Equivalent) (Nut. Div.) | Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Sodium bisulfate (Merck /BDH) (Nut. Div.) | Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 200/g
|
200/g | 475 PKR |
| Sodium carbonate (Merck /BDH) | Boric acid/potassium chloride/sodium carbonate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Sodium Chloride (AR grade) Scharlau/ equivalent (Nut. Div.) | Aminophylline/sodium chloride |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 12/Kg
|
12/Kg | 29 PKR |
| Sodium chromate (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Sodium hydroxide (Merck /BDH) (Nut. Div.) | Sodium hydroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 12/Kg
|
12/Kg | 29 PKR |
| Sodium sulphate (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Sodium thiosulphate (Merck /BDH) (Nut. Div.) | Amyl nitrite/sodium nitrite/sodium thiosulfate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Sodium tungtate (Merck /BDH) (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/g
|
100/g | 238 PKR |
| SPADNS, sodium 2-(parasulfophenylazo)-1,8-dihydroxy-3,6-naphthalene disulfonate, also called 4,5-dihydroxy-3-(parasulfophenylazo)-2,7 naphthalenedisulfonic acid trisodium salt (Nut. Div.) | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Kg
|
5/Kg | 12 PKR |
| Standard/Calibrator each of Na, K, Ca (1000 ppm or 500 ppm) (Nut. Div.) | Androgeny and fertility quality controls and calibrators and standards |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Starch soluble (AR grade) (Nut. Div.) | Benzethonium chloride/corn starch/kaolin/zinc oxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Kg
|
2/Kg | 5 PKR |
| Sucrose (Nut. Div.) | Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Sucrose (Merck /BDH) (Nut. Div.) | Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Sulfate HANNA Instrument (Nut. Div.) | Alcohol/sulfur/zinc oxide/zinc sulfate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Sulphate kit thermoscientific (Nut. Div.) | Sodium thiosulfate or thiosulfate or thiosulphate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Sulphuric Acid (conc) (AR grade) (Merck / BDH). (Nut. Div.) | Sulphuric acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 15/Qty
|
15/Qty | 89 PKR |
| Total Chlorine HANNA Instrument (Nut. Div.) | Chlorine Cl |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| Tri chloro acetic acid (Nut. Div.) | Acetic acid/benzalkonuim chloride/chloroxylenol/glycerin |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 5 PKR |
| Trifluoro Acetic Acid (AR grade) (Nut. Div.) | 5-hydroxyindole acetic acid/serotonin test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Ltr
|
10/Ltr | 24 PKR |
| Urea (Merck /BDH) (Nut. Div.) | Urea UF |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Kg
|
1/Kg | 2 PKR |
| Zinc acetate (Merck /BDH) (Nut. Div.) | Diphenhydramine/zinc acetate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1.5/Kg
|
1.5/Kg | 4 PKR |
| Zinc HANNA Instrument (Nut. Div.) | Alcohol/benzoic acid/boric acid/zinc oxide/zinc stearate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/box
|
3/box | 7 PKR |
| MacConkey agar purple CV (oxide eq) (Nut. Div.) | Chemical or pharmaceutical machinery or equipment manufacture services |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 4751 PKR |
| Plate count agar (Nut. Div.) | Polymerase chain reaction PCR tube strip and plate cooler |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Qty
|
10/Qty | 11878 PKR |
| Bismuth sulphite agar (Nut. Div.) | Benzocaine/bismuth subgallate/phenylmecuric nitrate/zinc oxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 3563 PKR |
| XLD agar (Nut. Div.) | Agar-agar |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 2376 PKR |
| Sabouraud Dextrose agar (Nut. Div.) | Anticoagulant citrate phosphate dextrose solution |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 2376 PKR |
| Simmons citrate agar (Nut. Div.) | Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 1188 PKR |
| Mannitol salt agar (Nut. Div.) | Amifostine/mannitol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 4751 PKR |
| Nutrient agar (Nut. Div.) | Nutrients |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 1188 PKR |
| Tryptone soya agar (Nut. Div.) | Tryptophan |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 1188 PKR |
| Motility agar (Nut. Div.) | Measurement of gastrointestinal motility, via natural or artificial opening |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 1188 PKR |
| EMB agar (Nut. Div.) | Agar-agar |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 4751 PKR |
| TCBS agar (Nut. Div.) | Agar-agar |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 1188 PKR |
| Peptone water (Nut. Div.) | Water |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 12/Qty
|
12/Qty | 14254 PKR |
| MacConkey broth purple CV-3 (Nut. Div.) | Mine action center MAC or mine action coordination center MACC service |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Qty
|
10/Qty | 11878 PKR |
| BGLB 20% (Nut. Div.) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 6/Qty
|
6/Qty | 7127 PKR |
| MR-VP broth (Nut. Div.) | Bottled broth media for bacteria |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 1188 PKR |
| Hydrogen peroxide 30% (Nut. Div.) | Carbamide peroxide or hydrogen peroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 475 PKR |
| Kovac's reagent (Nut. Div.) | Acid, alcohol, and decolorizing fluid reagents |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 713 PKR |
| Oxidase reagent (Nut. Div.) | Diagnosis of defects of catalase and peroxidase |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 475 PKR |
| Emulsion oil (Nut. Div.) | Emulsions |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 475 PKR |
| Barritt reagent-A (Nut. Div.) | Acetic acid, alcohol, and toluidine blue combination reagents |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 238 PKR |
| Barritt reagent-B (Nut. Div.) | Acetic acid, alcohol, and toluidine blue combination reagents |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 238 PKR |
| Methylated Spirit (Nut. Div.) | Camphor/eucalyptus oil/menthol/turpentine spirits |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 50/Ltr
|
50/Ltr | 119 PKR |
| Catalase test (Sigma Aldrich) (CMLT) | Diagnosis of defects of catalase and peroxidase |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/ml
|
500/ml | 1188 PKR |
| Oxidase test (Biomerieux) (CMLT) | Leukocyte peroxidase test |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/ml
|
500/ml | 1188 PKR |
| Ziehl Neelsen (Diacheme) (CMLT) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/set
|
1/set | 2 PKR |
| Field Stain set(Diacheme) (CMLT) | Field strength measuring equipment |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/ml
|
500/ml | 1188 PKR |
| Spirit Lamp (CMLT) | Camphor/eucalyptus oil/menthol/turpentine spirits |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Ltr
|
3/Ltr | 7 PKR |
| Disposable gloves (Nylon) (CMLT) | Chemical resistant gloves |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/pack
|
5/pack | 12 PKR |
| HCV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| HBs Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| HBs Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| HBe Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| HBe Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| HBc IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6-12 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| HB core IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| HAV Ab IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| HEV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 228 PKR |
| Toxoplasma IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Basic Diagnostic Procedures |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| Toxoplasma IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6-12 months\ CE-IVD/FDA approved 96 test (PHLD) | Diagnosis of toxoplasma hepatitis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| Rubella IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Diagnoses of rubella without complication |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| Rubella IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Diagnoses of rubella without complication |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| CMV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| CMV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| HSV IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| HSV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 2053 PKR |
| Measles IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Diagnoses of measles complicated by encephalitis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 2053 PKR |
| Measles IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Diagnoses of measles complicated by encephalitis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| Mumps IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Diagnoses of mumps pancreatitis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 912 PKR |
| Mumps IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Diagnoses of mumps pancreatitis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 228 PKR |
| VZV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 228 PKR |
| VZV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| EBV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 912 PKR |
| HIV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| Rabies Ab titer, Biorad/equivalent Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) | Diagnosis of sylvatic rabies |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 3649 PKR |
| Dengue Virus IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD) | Diagnosis of dengue haemorrhagic fever |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 5701 PKR |
| Dengue Virus IgG ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD) | Diagnosis of dengue haemorrhagic fever |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| Dengue Virus NS1 ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved. Detection of suspected target organism should be in one well 96 test | Diagnoses of dengue fever or classical dengue |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 4561 PKR |
| Dengue Virus IgG/IgM and NS1, Combo Rapid Test Kit(Qualitative) Should include all reagents Shelf life 6-12 months CE-IVD/FDA approved 25 test (PHLD) | Diagnoses of dengue fever or classical dengue |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 20/Qty
|
20/Qty | 23756 PKR |
| West Nile Fever Virus IgM ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD) | Diagnosis of west nile virus infection |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 228 PKR |
| Japanese Encephalitis IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD) | Diagnoses of australian encephalitis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| Mpox Virus Realtime-PCR Kit (Qualitative) positive and negative control, Must Detect both Clades (I &II) Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 48 test (PHLD) | Diagnosis of acute bronchiolitis due to human metapneumovirus |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 2851 PKR |
| CCHFV Realtime-PCR Kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 3649 PKR |
| Triplex Realtime-PCR kit for Dengue, Chikungunya & Zika Virus Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) | Triplex pumps |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 3649 PKR |
| Oropouche Virus Real Time PCR kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA/RUO approved For Human Specimen 96 test (PHLD) | Diagnoses of oropouche virus disease |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| Filo Virus Realtime-PCR Kits (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) | Butofilolol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 228 PKR |
| West Nile Fever Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) | Diagnosis of west nile virus infection |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 228 PKR |
| Varicella-Zoster Virus Realtime-PCR Kit (Qualitative) positive and negative control shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) | Diagnosis of disseminated zoster |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| CMV Real Time PCR kit (Qualitative) positive and negative control: Shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test. (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 228 PKR |
| HSV Real Time Kit (Qualitative) Must Identify HSV-1 and HSV-2 in single reaction positive and negative control shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen 96 test (PHLD) | Oilfield real time well data monitoring services |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 912 PKR |
| Rabies Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) | Rabies vaccine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 228 PKR |
| Realtime-PCR Kit of Hepatitis B Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included | Oilfield real time well data monitoring services |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Realtime-PCR Kit of Hepatitis C Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved\ I | Oilfield real time well data monitoring services |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Trioplex Realtime -PCR Kit for SARS-CoV-2, Flu A & B, RSV, Target Pathogens: SARS-CoV-2, Influenza A (including H1N1 and H3N2), Influenza B, Respiratory Syncytial Virus (RSV A/B) Specimen Type: Nasopharyngeal swabs, oropharyngeal swabs Internal Cont | Oilfield real time well data monitoring services |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Qty
|
10/Qty | 228 PKR |
| Positive Control for Oropouche Virus Type: Inactivated virus / Plasmid control Form: Lyophilized Purpose: Use as a positive control in molecular diagnostic assays (e.g., real-time RT-PCR, conventional RT-PCR) for OROV Volume: Minimum 100µL per via | Diagnoses of oropouche virus disease |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/Qty
|
100/Qty | 2 PKR |
| MAYV_FNF, 5’-CACGGACMTTTTGCCTTCA 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 228 PKR |
| MAYV_FNR, 5’-AGACTGCCACCTCTGCTKGAG 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 2 PKR |
| MAYV_FNP, 5’-VIC-ACAGATCAGACATGCAGG-NFQ-MGB 200nm HPLC (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| OROV_FNF,5’-TCCGGAGGCAGCATATGTG 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| OROV_FNR, 5’-ACAACACCAGCATTGAGCACTT 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| OROV_FNP, 5’-FAM-CATTTGAAGCTAGATACGG-NFQ-MGB 200nm HPLC (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| NF5,TGAGTGCTCTCCAACTTCTGCAGT 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| NR5,TTCTTCAGAGCTTGCATCTTGAT 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| PF1,TTTAATCGACATGGGAGCAATTG 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| PR1, TAAGGTGGGTCAGACGGAGAGA 50nm DeSalt (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| TaqMan MGB Probe, VIC-AGAATTCATCCTGGCAGCT-NFQ 200 nm HPLC (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| RA Factor Latex 100 tests(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 20/Qty
|
20/Qty | 48 PKR |
| CRP Latex 100 tests(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 20/Qty
|
20/Qty | 48 PKR |
| Anti IgA Ab ( Manual Elisa )(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 15/Qty
|
15/Qty | 36 PKR |
| Anti CCP IgGAb ( Manual Elisa)(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 7/Qty
|
7/Qty | 17 PKR |
| ANA IgG kit Elisa (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 5 PKR |
| BrucellaAb Latex 100 tests(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 5 PKR |
| ASO Titter Latex 100 tests(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| ICT MP Devices(PHLD) | Altitude measuring devices |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/Qty
|
100/Qty | 238 PKR |
| Anti TTG IgG Elisa Manual(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 15/Qty
|
15/Qty | 36 PKR |
| Anti DeaminatedgladinAb ( Elisa ) DGP IgG(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 15/Qty
|
15/Qty | 36 PKR |
| H Pylori for stool Antigen Devices (PHLD) | Diagnosis of adult hypertrophic pyloric stenosis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 800/Qty
|
800/Qty | 1900 PKR |
| Total Immunoglobulin A Elisa kit(PHLD) | Bacterial immunoglobulins |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| VDRL Latex kit 100 tests(PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 7 PKR |
| H Pylori IgM Antibodies Elisa kit 96 tests(PHLD) | Diagnosis of adult hypertrophic pyloric stenosis |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 8/Qty
|
8/Qty | 19 PKR |
| Urine Pregnancy Kit (PHLD) | The diagnosis of extravasation of urine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/Qty
|
100/Qty | 238 PKR |
| Occult Blood Kit (PHLD) | Occult blood test |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/Qty
|
100/Qty | 238 PKR |
| Streptococcus grouping kit (Thermo) (PHLD) | Diagnosis of acute bronchitis due to streptococcus |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 238 PKR |
| G6PD Test Kit (Qualitative Method) (Span Diagnostics, France) (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Qty
|
10/Qty | 5 PKR |
| ABO Blood Grouping Kit, (Atlas Medical, Germany) (03x10ml/kit) (PHLD) | Kits or enzymes for sequencing |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 6/Qty
|
6/Qty | 24 PKR |
| Absolute ethanol, molecular biology grade (2.5 liter Pack) (PHLD) | Benzocaine/chlorobutanol/ethanol/menthol/tannic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Qty
|
10/Qty | 14 PKR |
| Sodium hypochlorite Solution) 100% (PHLD) | Benzalkonium chloride/edetate/sodium hydroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 10/Ltr
|
10/Ltr | 24 PKR |
| Medium RPMI 1640 (!X) Without L-Glutamine Ref No 21870-076, Lot No. 2518007 Gibco company 500 ml (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 7 PKR |
| Phytohaemagglutinin (PHA)- CAT No. 151884-MP Biomedicals, LLC (Pack of 10mg)(PHLD) | Phytotron |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| Fetal Bovine Serum (FBS) (Pack of 100 ml) (PHLD) | Bovine semen |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Penicillin Streptomycin (PSS) ICN/ Sigma /Equivalent (Pack of 100 ml) (PHLD) | Adicillin or penicillin n |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| L-Glutamine (ICN, Cat No. 16-801049) (Pack of 100 ml) (PHLD) | Glutamine |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Ethanol (Merck/BDH/Equal) (Pack of 2.5 lit) | Benzocaine/chlorobutanol/ethanol/menthol/tannic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Methanol (Merck/BDH/Equal) (Pack of 2.5 lit) (PHLD) | Methanol |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 5 PKR |
| Glycerin (Pack of 2.5 lit)(PHLD) | Acetic acid/antipyrine/benzocaine/glycerin |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Acetic Acid Ct No 40766363-Merk (Pack of 2.5 lit) (PHLD) | Acetic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Nuclease free water Invitrogen Ultra Pure Distilled Water Dnase/RNase free (500ml) (PHLD) | Chloramphenicol/desoxyribonuclease/fibrinolysin |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 15/Qty
|
15/Qty | 36 PKR |
| Absolute Ethanol (2.5L) (PHLD) | Benzocaine/chlorobutanol/ethanol/menthol/tannic acid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 4/Qty
|
4/Qty | 10 PKR |
| PCR Tubes with strips (0.2ml) thin walled PCR Tubes strip with indidual flat cap Dnase,RNase and pyrogen free 120 strip/Pack NEST Biotechnology (PHLD) | Polymerase chain reaction PCR tube strip and plate cooler |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 20/Qty
|
20/Qty | 48 PKR |
| Anaerobic gas pack( pack of 10) (PHLD) | Anaerobic jars or accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/pack
|
2/pack | 5 PKR |
| Potassium hydroxide (PHLD) | Potassium hydroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/g
|
500/g | 1188 PKR |
| Potassium Tellurite` | Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 25/g
|
25/g | 59 PKR |
| (HCL) concentrated (PHLD) | Bisacodyl/docusate/senna concentrate/senna extract/sucrose |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2.5/Ltr
|
2.5/Ltr | 6 PKR |
| Hydrogen Peroxide (PHLD) | Carbamide peroxide or hydrogen peroxide |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/ml
|
500/ml | 1188 PKR |
| Glycerin (Glycerol) 87%, Merck (Pack of 2.5) (PHLD) | Acetic acid/antipyrine/benzocaine/glycerin |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 3/Qty
|
3/Qty | 7 PKR |
| Hand Disinfectant/ Antiseptic (PHLD) | Dialysate delivery system disinfectants |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 24/Qty
|
24/Qty | 57 PKR |
| Hypochlorite (KOSDAQ ) 6-14% (PHLD) | Sodium hypochlorite |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 24/Kg
|
24/Kg | 57 PKR |
| Culti Loops Thermofisher or equivalent ATCC 49226 Neisseria gonorrhoeae (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Culti Loops Thermofisher or equivalent ATCC 43300 S. aureus methicillin resistant control (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Culti Loops Thermofisher or equivalent ATCC 27853Peudomonasaeruginosa (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Culti Loops Thermofisher or equivalent ATCC 25922 E.coli (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Culti Loops Thermofisher or equivalent ATCC 19615 S.pyogenes (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Culti Loops Thermofisher or equivalent ATCC 27012 C. diphtheria (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Culti Loops Thermofisher or equivalent ATCC 27010 C. diphtheria (PHLD) | Industrial chemical equipment spare parts and accessories |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 1/Qty
|
1/Qty | 2 PKR |
| Bovine Albumin 22 %(Atlas Medical, Germany) ( Pack of 10ml) (PHLD) | Bovine production services |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Qty
|
2/Qty | 5 PKR |
| Anti-Human Globulin(Atlas Medical, Germany) ( Pack of 10ml) (PHLD) | Alpha-2-macroglobulin immunological test system |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/pack
|
2/pack | 5 PKR |
| Hand Sanitizer (liquid)(OROSEPT Solution) ( Pack of 500ml) (PHLD) | Hand sanitizer |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 5/Qty
|
5/Qty | 12 PKR |
| Immersion Oil for Microscopy, (Sigma-Aldrich Co., USA) ( Pack of500ml) (PHLD) | Microscope immersion oil |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 500/ml
|
500/ml | 1188 PKR |
| Reticulocyte Count Stain ( Pack of 100 ml) (Diachem ) (PHLD) | Diagnosis of actinic reticuloid |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 100/ml
|
100/ml | 238 PKR |
| Giemsa Stain (Pack of 1000ml) (Merck, KGaA, Germany) (PHLD) | Alloy steel/stainless steel check valve |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 2/Ltr
|
2/Ltr | 8 PKR |
| Spirit (PHLD) | Spirits or liquors |
Address: Park Road, Islamabad Capital Territory
Schedule: 27 Days
Quantity: 200/Ltr
|
200/Ltr | 297371 PKR |
Related Services of Goods:
No
Items/Lot Specification
Items Without Lots :
Item: Spirit Rectified, (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)
UNSPSC: Spirits or liquors
Specifications / Requirementsss:
Spirit Rectified, (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)Item: Chloroform (AR grade), (Merck / BDH/ Equivalent) (Nut. Div.)
UNSPSC: Chloroform
Specifications / Requirementsss:
Chloroform (AR grade), (Merck / BDH/ Equivalent) (Nut. Div.)Item: (AR grade) (Merck /BDH/ equivalent) NH4 OH (Nut. Div.)2.5 ltr
UNSPSC: Chemical management service
Specifications / Requirementsss:
(AR grade) (Merck /BDH/ equivalent) NH4 OH (Nut. Div.)Item: (Merck / BDH/ equipment) (Nut. Div.)
UNSPSC: Equipment inspection service
Specifications / Requirementsss:
(Merck / BDH/ equipment) (Nut. Div.)Item: (Merck / BDH/ Equivalent (Nut. Div.)
UNSPSC: Equipment inspection service
Specifications / Requirementsss:
(Merck / BDH/ Equivalent (Nut. Div.)Item: Absolute Ethanol (AR grade) (Nut. Div.)
UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Specifications / Requirementsss:
Absolute Ethanol (AR grade) (Nut. Div.)Item: Acetic Acid Glacial (AR grade) (Nut. Div.)
UNSPSC: Acetic acid
Specifications / Requirementsss:
Acetic Acid Glacial (AR grade) (Nut. Div.)Item: Acetic Acid Glacial (AR grade) Scharlau/ equivalent (Nut. Div.)
UNSPSC: Acetic acid
Specifications / Requirementsss:
Acetic Acid Glacial (AR grade) Scharlau/ equivalent (Nut. Div.)Item: Acetone GC grade (Merck /BDH) (Nut. Div.)
UNSPSC: Acetone/alcohol
Specifications / Requirementsss:
Acetone GC grade (Merck /BDH) (Nut. Div.)Item: Acetonitrile (Nut. Div.)
UNSPSC: Acetonitrile
Specifications / Requirementsss:
Acetonitrile (Nut. Div.)Item: Acidum formicium (Nut. Div.)
UNSPSC: 2,3-diphosphoglyceric acid test system
Specifications / Requirementsss:
Acidum formicium (Nut. Div.)Item: Agra Strip Pro (Total Aflatoxin) Romer Lab (Nut. Div.)
UNSPSC: Binding combs or strips
Specifications / Requirementsss:
Agra Strip Pro (Total Aflatoxin) Romer Lab (Nut. Div.)Item: Alkalinity HANNA Instrument (Nut. Div.)
UNSPSC: Alkaline phosphatase or isoenzymes test system
Specifications / Requirementsss:
Alkalinity HANNA Instrument (Nut. Div.)Item: Aluminum HANNA Instrument (Nut. Div.)
UNSPSC: Acetaminophen/aluminum acetate/chlorpheniramine/phenylpropanolam
Specifications / Requirementsss:
Aluminum HANNA Instrument (Nut. Div.)Item: Aluminum oxid (Nut. Div.)
UNSPSC: Aluminum oxide
Specifications / Requirementsss:
Aluminum oxid (Nut. Div.)Item: Ammonia HR HANNA Instrument (Nut. Div.)
UNSPSC: Ammonia
Specifications / Requirementsss:
Ammonia HR HANNA Instrument (Nut. Div.)Item: Ammonium Chloride (Merck / BDH) (Nut. Div.)
UNSPSC: Aminophylline/ammonium chloride/diphenhydramine
Specifications / Requirementsss:
Ammonium Chloride (Merck / BDH) (Nut. Div.)Item: Ammonium Hydroxide (conc) (Nut. Div.)
UNSPSC: Ammonium hydroxide titrants
Specifications / Requirementsss:
Ammonium Hydroxide (conc) (Nut. Div.)Item: Ammonium molybdate (Merck /BDH) (Nut. Div.)
UNSPSC: Aminophylline/ammonium chloride/diphenhydramine
Specifications / Requirementsss:
Ammonium molybdate (Merck /BDH) (Nut. Div.)Item: Amyl alcohol (Nut. Div.)2.5ltr
UNSPSC: Acetone/alcohol
Specifications / Requirementsss:
Amyl alcohol (Nut. Div.)Item: Anhydrous Sodium Fluoride (Nut. Div.)
UNSPSC: Calcium carbonate/sodium fluoride
Specifications / Requirementsss:
Anhydrous Sodium Fluoride (Nut. Div.)Item: Antifoam tablets (Nut. Div.)
UNSPSC: Anti foaming agents
Specifications / Requirementsss:
Antifoam tablets (Nut. Div.)Item: Arsenic Test Supelco Kit (Nut. Div.)
UNSPSC: Arsenic test system
Specifications / Requirementsss:
Arsenic Test Supelco Kit (Nut. Div.)Item: Ascorbic Acid (AR grade) (Nut. Div.)
UNSPSC: Ascorbic acid
Specifications / Requirementsss:
Ascorbic Acid (AR grade) (Nut. Div.)Item: Barium Chloride (Merk /BDH) (Nut. Div.)
UNSPSC: Barium Ba
Specifications / Requirementsss:
Barium Chloride (Merk /BDH) (Nut. Div.)Item: Barium Chloride AR Grade (Merck/ BDH) / equivalent (Nut. Div.)
UNSPSC: Barium Ba
Specifications / Requirementsss:
Barium Chloride AR Grade (Merck/ BDH) / equivalent (Nut. Div.)Item: Benzoic acid (Nut. Div.)
UNSPSC: 4-aminobenzoic acid or Aminobenzoic acid or PABA or para-aminobenzoic acid
Specifications / Requirementsss:
Benzoic acid (Nut. Div.)Item: Boric Acid (AR grade) (Nut. Div.)
UNSPSC: Acetone/basic fuchsin/boric acid/resorcinol
Specifications / Requirementsss:
Boric Acid (AR grade) (Nut. Div.)Item: Bromine HANNA Instrument (Nut. Div.)
UNSPSC: Bromine Br
Specifications / Requirementsss:
Bromine HANNA Instrument (Nut. Div.)Item: Bromocresol green (Nut. Div.)
UNSPSC: Bromocriptine
Specifications / Requirementsss:
Bromocresol green (Nut. Div.)Item: Bromocresol green (Merck /BDH) (Nut. Div.)
UNSPSC: Bromocriptine
Specifications / Requirementsss:
Bromocresol green (Merck /BDH) (Nut. Div.)Item: Bromocresol purple (Merck /BDH) (Nut. Div.)
UNSPSC: Bromocriptine
Specifications / Requirementsss:
Bromocresol purple (Merck /BDH) (Nut. Div.)Item: Bromophenol blue (Nut. Div.)
UNSPSC: Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium
Specifications / Requirementsss:
Bromophenol blue (Nut. Div.)Item: Bromothymol Blue (BTB) (Nut. Div.)
UNSPSC: Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium
Specifications / Requirementsss:
Bromothymol Blue (BTB) (Nut. Div.)Item: Calcium carbonate (Nut. Div.)
UNSPSC: Acetaminophen/aspirin/calcium carbonate
Specifications / Requirementsss:
Calcium carbonate (Nut. Div.)Item: Calcium Carbonate (Merck/ equivalent) (Nut. Div.)
UNSPSC: Acetaminophen/aspirin/calcium carbonate
Specifications / Requirementsss:
Calcium Carbonate (Merck/ equivalent) (Nut. Div.)Item: Calcium Colorimetric assay kits (Nut. Div.)
UNSPSC: Calcium
Specifications / Requirementsss:
Calcium Colorimetric assay kits (Nut. Div.)Item: Calcium HANNA Instrument (Nut. Div.)
UNSPSC: Calcium
Specifications / Requirementsss:
Calcium HANNA Instrument (Nut. Div.)Item: Calcium Marine HANNA Instrument (Nut. Div.)
UNSPSC: Calcium
Specifications / Requirementsss:
Calcium Marine HANNA Instrument (Nut. Div.)Item: Calcium oxide (Nut. Div.)
UNSPSC: Calcium oxide
Specifications / Requirementsss:
Calcium oxide (Nut. Div.)Item: Catalyst tablets for kjeldahl method (Nut. Div.)
UNSPSC: Acid catalysts
Specifications / Requirementsss:
Catalyst tablets for kjeldahl method (Nut. Div.)Item: CDTA (Cyclohexylenediaminetetraacetic acid) (Nut. Div.)
UNSPSC: Nandrolone cyclohexylpropionate
Specifications / Requirementsss:
CDTA (Cyclohexylenediaminetetraacetic acid) (Nut. Div.)Item: Charcoal (Nut. Div.)
UNSPSC: Charcoal
Specifications / Requirementsss:
Charcoal (Nut. Div.)Item: Chlorine Test Kit 6991 LP-DPD Tablets Octet Comparator 0.01 to 1 Ppm and 1.0 to 6.0 Ppm (LA Motte/ Equivalent) (Nut. Div.)
UNSPSC: Chlorine Cl
Specifications / Requirementsss:
Chlorine Test Kit 6991 LP-DPD Tablets Octet Comparator 0.01 to 1 Ppm and 1.0 to 6.0 Ppm (LA Motte/ Equivalent) (Nut. Div.)Item: Chloroform (AR grade) (Nut. Div.)
UNSPSC: Chloroform
Specifications / Requirementsss:
Chloroform (AR grade) (Nut. Div.)Item: Choarcoal activated AR grade (Nut. Div.)
UNSPSC: Charcoal
Specifications / Requirementsss:
Choarcoal activated AR grade (Nut. Div.)Item: Chromium Vi LR HANNA Instrument (Nut. Div.)
UNSPSC: Chromium Cr
Specifications / Requirementsss:
Chromium Vi LR HANNA Instrument (Nut. Div.)Item: Citric acid (Nut. Div.)
UNSPSC: Alcohol/citric acid/salicylic acid
Specifications / Requirementsss:
Citric acid (Nut. Div.)Item: Citric Acid (Commercial grade) (Nut. Div.)
UNSPSC: Alcohol/citric acid/salicylic acid
Specifications / Requirementsss:
Citric Acid (Commercial grade) (Nut. Div.)Item: Copper acetate (Nut. Div.)
UNSPSC: Copper
Specifications / Requirementsss:
Copper acetate (Nut. Div.)Item: Copper acetate(Merck /BDH) (Nut. Div.)
UNSPSC: Copper
Specifications / Requirementsss:
Copper acetate(Merck /BDH) (Nut. Div.)Item: Copper HR HANNA Instrument (Nut. Div.)
UNSPSC: Copper
Specifications / Requirementsss:
Copper HR HANNA Instrument (Nut. Div.)Item: Copper sulphate (Nut. Div.)
UNSPSC: Copper sulfate
Specifications / Requirementsss:
Copper sulphate (Nut. Div.)Item: Copper sulphate (Merck /BDH) (Nut. Div.)
UNSPSC: Copper sulfate
Specifications / Requirementsss:
Copper sulphate (Merck /BDH) (Nut. Div.)Item: Cupric carbonate (Nut. Div.)
UNSPSC: Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride
Specifications / Requirementsss:
Cupric carbonate (Nut. Div.)Item: Cupric sulphate pentahydrate (Merck /BDH) (Nut. Div.)
UNSPSC: Chromic chloride/cupric sulfate/manganese sulfate/selenium/zinc
Specifications / Requirementsss:
Cupric sulphate pentahydrate (Merck /BDH) (Nut. Div.)Item: Di sodium EDTA (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Di sodium EDTA (Nut. Div.)Item: Diethyl ether (Nut. Div.)
UNSPSC: Diethyl ether or ether
Specifications / Requirementsss:
Diethyl ether (Nut. Div.)Item: Dimethylglyoxim (Nut. Div.)
UNSPSC: Didecyldimethylammonium chloride
Specifications / Requirementsss:
Dimethylglyoxim (Nut. Div.)Item: Diphenyl carbazide (Merck /BDH) (Nut. Div.)
UNSPSC: Diphenylhydantoin test system
Specifications / Requirementsss:
Diphenyl carbazide (Merck /BDH) (Nut. Div.)Item: Diphenylthiocarbazone (Merck /BDH) (Nut. Div.)
UNSPSC: Diphenylhydantoin test system
Specifications / Requirementsss:
Diphenylthiocarbazone (Merck /BDH) (Nut. Div.)Item: Dissolved Oxygen HANNA Instrument (Nut. Div.)
UNSPSC: Dissolved oxygen meters
Specifications / Requirementsss:
Dissolved Oxygen HANNA Instrument (Nut. Div.)Item: EDTA AR Grade (Merck/ equivalent) (Nut. Div.)
UNSPSC: Benzalkonium chloride/edta
Specifications / Requirementsss:
EDTA AR Grade (Merck/ equivalent) (Nut. Div.)Item: Ferric chloride (Nut. Div.)
UNSPSC: Ferric chloride colorimetric preparation
Specifications / Requirementsss:
Ferric chloride (Nut. Div.)Item: Ferric chloride (Merck /BDH) (Nut. Div.)
UNSPSC: Ferric chloride colorimetric preparation
Specifications / Requirementsss:
Ferric chloride (Merck /BDH) (Nut. Div.)Item: Ferric citrate (Nut. Div.)
UNSPSC: Ferric chloride colorimetric preparation
Specifications / Requirementsss:
Ferric citrate (Nut. Div.)Item: Florisil (Nut. Div.)
UNSPSC: Dried cut french florissa tulip
Specifications / Requirementsss:
Florisil (Nut. Div.)Item: Flouride Test Kit (Nut. Div.)
UNSPSC: Blood bank test kits or supplies
Specifications / Requirementsss:
Flouride Test Kit (Nut. Div.)Item: Fluoride Test Kit (Merck/ equivalent) (Nut. Div.)
UNSPSC: Androgeny and fertility test kits and supplies
Specifications / Requirementsss:
Fluoride Test Kit (Merck/ equivalent) (Nut. Div.)Item: Formaldehyde (Nut. Div.)
UNSPSC: Aluminum chlorohydrex/formaldehyde/menthol/zinc undecylenate
Specifications / Requirementsss:
Formaldehyde (Nut. Div.)Item: Foroglucinol (Merck /BDH) (Nut. Div.)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Foroglucinol (Merck /BDH) (Nut. Div.)Item: Glucose (Merck /BDH) (Nut. Div.)
UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Specifications / Requirementsss:
Glucose (Merck /BDH) (Nut. Div.)Item: Glycerin (AR grade) Scharlau/ equivalent (Nut. Div.)
UNSPSC: Acetic acid/antipyrine/benzocaine/glycerin
Specifications / Requirementsss:
Glycerin (AR grade) Scharlau/ equivalent (Nut. Div.)Item: Hydrochloric Acid (Merck /Eq.) (Nut. Div.)
UNSPSC: Hydrochloric acid
Specifications / Requirementsss:
Hydrochloric Acid (Merck /Eq.) (Nut. Div.)Item: Hydrochloric Acid (conc) (AR grade) (Merck /BDH/ equivalent) (Nut. Div.)
UNSPSC: Hydrochloric acid
Specifications / Requirementsss:
Hydrochloric Acid (conc) (AR grade) (Merck /BDH/ equivalent) (Nut. Div.)Item: Hydrogen peroxide (Nut. Div.)
UNSPSC: Carbamide peroxide or hydrogen peroxide
Specifications / Requirementsss:
Hydrogen peroxide (Nut. Div.)Item: Hydrogen peroxide (AR grade) Scharlau/ equivalent (Nut. Div.)
UNSPSC: Carbamide peroxide or hydrogen peroxide
Specifications / Requirementsss:
Hydrogen peroxide (AR grade) Scharlau/ equivalent (Nut. Div.)Item: Iodine crystals (Merck /BDH) (Nut. Div.)
UNSPSC: Calcium/iodine
Specifications / Requirementsss:
Iodine crystals (Merck /BDH) (Nut. Div.)Item: Iodine HANNA Instrument (Nut. Div.)
UNSPSC: Calcium/iodine
Specifications / Requirementsss:
Iodine HANNA Instrument (Nut. Div.)Item: Iron HR HANNA Instrument (Nut. Div.)
UNSPSC: Iron Fe
Specifications / Requirementsss:
Iron HR HANNA Instrument (Nut. Div.)Item: Kaliumdichromate (Nut. Div.)
UNSPSC: Chromate standards
Specifications / Requirementsss:
Kaliumdichromate (Nut. Div.)Item: Kaliumjodid reinst (Nut. Div.)
UNSPSC: Acid or alkali resistant castable
Specifications / Requirementsss:
Kaliumjodid reinst (Nut. Div.)Item: Lead chromate (Merck /BDH) (Nut. Div.)
UNSPSC: Chromate standards
Specifications / Requirementsss:
Lead chromate (Merck /BDH) (Nut. Div.)Item: Magnesium HANNA Instrument (Nut. Div.)
UNSPSC: Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr
Specifications / Requirementsss:
Magnesium HANNA Instrument (Nut. Div.)Item: Magnesium Sulfate (Merck/BDH) (Nut. Div.)
UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Specifications / Requirementsss:
Magnesium Sulfate (Merck/BDH) (Nut. Div.)Item: Magnesium Sulfate Ar Grade (Merck /BDH) / (Nut. Div.) equivalent
UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Specifications / Requirementsss:
Magnesium Sulfate Ar Grade (Merck /BDH) / (Nut. Div.) equivalentItem: Magnesium sulfate hepta hydrate (Merck /BDH) (Nut. Div.)
UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Specifications / Requirementsss:
Magnesium sulfate hepta hydrate (Merck /BDH) (Nut. Div.)Item: Magnesium system reagent Thermoscientific (Nut. Div.)
UNSPSC: Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr
Specifications / Requirementsss:
Magnesium system reagent Thermoscientific (Nut. Div.)Item: Magnesium Test Kit (Merck/Equivalent) (Nut. Div.)
UNSPSC: Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr
Specifications / Requirementsss:
Magnesium Test Kit (Merck/Equivalent) (Nut. Div.)Item: Manganese HR HANNA Instrument (Nut. Div.)
UNSPSC: Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride
Specifications / Requirementsss:
Manganese HR HANNA Instrument (Nut. Div.)Item: Megnisumnitrat (Nut. Div.)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Megnisumnitrat (Nut. Div.)Item: Methanol (HPLC grade) (Nut. Div.)
UNSPSC: Methanol
Specifications / Requirementsss:
Methanol (HPLC grade) (Nut. Div.)Item: Methyl orange indicator (Nut. Div.)
UNSPSC: 3-methylmorphine or codeine
Specifications / Requirementsss:
Methyl orange indicator (Nut. Div.)Item: Methyl red (Nut. Div.)
UNSPSC: 3-methylmorphine or codeine
Specifications / Requirementsss:
Methyl red (Nut. Div.)Item: Methyl Red ( AR grade) (Merck /BDH) (Nut. Div.)
UNSPSC: 3-methylmorphine or codeine
Specifications / Requirementsss:
Methyl Red ( AR grade) (Merck /BDH) (Nut. Div.)Item: Methylene blue (Nut. Div.)
UNSPSC: 3,4-methylenedioxyphenyl-2-propanone
Specifications / Requirementsss:
Methylene blue (Nut. Div.)Item: Methylene blue (Merck /BDH) (AR grade) (Nut. Div.)
UNSPSC: 3,4-methylenedioxyphenyl-2-propanone
Specifications / Requirementsss:
Methylene blue (Merck /BDH) (AR grade) (Nut. Div.)Item: Natrium hydrogen carbonates (Nut. Div.)
UNSPSC: 6-phosphogluconate dehydrogenase test system
Specifications / Requirementsss:
Natrium hydrogen carbonates (Nut. Div.)Item: Natrium oxalate (Nut. Div.)
UNSPSC: B-type natriuretic peptide test system
Specifications / Requirementsss:
Natrium oxalate (Nut. Div.)Item: n-hexane (HPLC grade) (Nut. Div.)
UNSPSC: Nandrolone cyclohexanecarboxylate
Specifications / Requirementsss:
n-hexane (HPLC grade) (Nut. Div.)Item: Nickel HR HANNA Instrument (Nut. Div.)
UNSPSC: Cast coated anisotropic ferrous aluminum nickel cobalt magnet
Specifications / Requirementsss:
Nickel HR HANNA Instrument (Nut. Div.)Item: Nitrate HANNA Instrument (Nut. Div.)
UNSPSC: Aminoethyl nitrate
Specifications / Requirementsss:
Nitrate HANNA Instrument (Nut. Div.)Item: Nitrate kit thermoscientific (Nut. Div.)
UNSPSC: Aminoethyl nitrate
Specifications / Requirementsss:
Nitrate kit thermoscientific (Nut. Div.)Item: Nitric Acid (AR grade) (Nut. Div.)
UNSPSC: The diagnosis of toxic effect of nitroglycerin and nitric acids and esters
Specifications / Requirementsss:
Nitric Acid (AR grade) (Nut. Div.)Item: Nitrite HR HANNA Instrument (Nut. Div.)
UNSPSC: Amyl nitrite/sodium nitrite/sodium thiosulfate
Specifications / Requirementsss:
Nitrite HR HANNA Instrument (Nut. Div.)Item: Nitrium chloride (Nut. Div.)
UNSPSC: Calcium/chloride/gluconate/magnesium/potassium/sodium/sulfate
Specifications / Requirementsss:
Nitrium chloride (Nut. Div.)Item: Ozone HANNA Instrument (Nut. Div.)
UNSPSC: Ozone analyzers
Specifications / Requirementsss:
Ozone HANNA Instrument (Nut. Div.)Item: Pepsin (Nut. Div.)
UNSPSC: Amylase/bile salts/dehydrocholic acid/lipase/pepsin/proteolytic
Specifications / Requirementsss:
Pepsin (Nut. Div.)Item: Petroleum ether (40-60 oC) (AR grade) (Nut. Div.)
UNSPSC: Petroleum or chemical trucking service
Specifications / Requirementsss:
Petroleum ether (40-60 oC) (AR grade) (Nut. Div.)Item: pH Buffer Tablet (10.00 + 0.02) BDH / equivalent (Nut. Div.)
UNSPSC: Buffer solutions
Specifications / Requirementsss:
pH Buffer Tablet (10.00 + 0.02) BDH / equivalent (Nut. Div.)Item: PH buffer tablet (4.0+0.02) BDH / equivalent (Nut. Div.)
UNSPSC: Buffer solutions
Specifications / Requirementsss:
PH buffer tablet (4.0+0.02) BDH / equivalent (Nut. Div.)Item: pH Buffer Tablet (7.00 + 0.02) BDH / equivalent (Nut. Div.)
UNSPSC: Buffer solutions
Specifications / Requirementsss:
pH Buffer Tablet (7.00 + 0.02) BDH / equivalent (Nut. Div.)Item: Phenolphthalein indicator (Nut. Div.)
UNSPSC: Bisacodyl/magnesium citrate/phenolphthalein
Specifications / Requirementsss:
Phenolphthalein indicator (Nut. Div.)Item: Phenolphthalein indicator (Merck /BDH) (Nut. Div.)
UNSPSC: Bisacodyl/magnesium citrate/phenolphthalein
Specifications / Requirementsss:
Phenolphthalein indicator (Merck /BDH) (Nut. Div.)Item: Pholoroglucinol (Merck /BDH) (Nut. Div.)
UNSPSC: Diagnosis of isolated proteinuria with specified morphological lesion, dense deposit disease
Specifications / Requirementsss:
Pholoroglucinol (Merck /BDH) (Nut. Div.)Item: Phosphate HR HANNA Instrument (Nut. Div.)
UNSPSC: Acid phosphatase
Specifications / Requirementsss:
Phosphate HR HANNA Instrument (Nut. Div.)Item: Phosphomolybdic Acid (Merck /BDH) (Nut. Div.)
UNSPSC: 2,3-diphosphoglyceric acid test system
Specifications / Requirementsss:
Phosphomolybdic Acid (Merck /BDH) (Nut. Div.)Item: Phosphorus penta Oxide (AR grade) Scharlau/ equivalent (Nut. Div.)
UNSPSC: Diagnosis of disorders of phosphorus metabolism and phosphatases
Specifications / Requirementsss:
Phosphorus penta Oxide (AR grade) Scharlau/ equivalent (Nut. Div.)Item: Ploroglucinol (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)
UNSPSC: Exploration or development system spare parts or accessories
Specifications / Requirementsss:
Ploroglucinol (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)Item: Potassium Chloride AR grade (Merck/ BDH) / equivalent (Nut. Div.)
UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Specifications / Requirementsss:
Potassium Chloride AR grade (Merck/ BDH) / equivalent (Nut. Div.)Item: Potassium Chloride (Merck/ BDH) (Nut. Div.)
UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Specifications / Requirementsss:
Potassium Chloride (Merck/ BDH) (Nut. Div.)Item: Potassium Chromate AR Grade (Merck /BDH) / equivalent (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Potassium Chromate AR Grade (Merck /BDH) / equivalent (Nut. Div.)Item: Potassium dichromate (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Potassium dichromate (Nut. Div.)Item: Potassium ferricyanide (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Potassium ferricyanide (Nut. Div.)Item: Potassium ferricyanide (Merck /BDH) (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Potassium ferricyanide (Merck /BDH) (Nut. Div.)Item: Potassium HANNA Instrument (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Potassium HANNA Instrument (Nut. Div.)Item: Potassium hydrogen phthalate (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Potassium hydrogen phthalate (Nut. Div.)Item: Potassium Hydroxide (AR grade) Scharlau/ equivalent (Nut. Div.)
UNSPSC: Potassium hydroxide
Specifications / Requirementsss:
Potassium Hydroxide (AR grade) Scharlau/ equivalent (Nut. Div.)Item: Potassium Iodide (Scharlau) (Nut. Div.)
UNSPSC: Aminophylline/ephedrine/phenobarbital/potassium iodide
Specifications / Requirementsss:
Potassium Iodide (Scharlau) (Nut. Div.)Item: Potassium sodium tartrate (Nut. Div.)
UNSPSC: Potassium sodium tartrate
Specifications / Requirementsss:
Potassium sodium tartrate (Nut. Div.)Item: Resorcinol (Nut. Div.)
UNSPSC: Acetone/basic fuchsin/boric acid/resorcinol
Specifications / Requirementsss:
Resorcinol (Nut. Div.)Item: Resorcinol (Merck /BDH) (Nut. Div.)
UNSPSC: Acetone/basic fuchsin/boric acid/resorcinol
Specifications / Requirementsss:
Resorcinol (Merck /BDH) (Nut. Div.)Item: Salicylasure gefallt (Nut. Div.)
UNSPSC: Aceclidine salicylate
Specifications / Requirementsss:
Salicylasure gefallt (Nut. Div.)Item: Silica gel (Nut. Div.)
UNSPSC: Silica gel
Specifications / Requirementsss:
Silica gel (Nut. Div.)Item: Silver nitrate AR Grade (Merck/ equivalent) (Nut. Div.)
UNSPSC: Silver nitrate
Specifications / Requirementsss:
Silver nitrate AR Grade (Merck/ equivalent) (Nut. Div.)Item: Sodium acetate (Merck /BDH) (Nut. Div.)
UNSPSC: Sodium acetate
Specifications / Requirementsss:
Sodium acetate (Merck /BDH) (Nut. Div.)Item: Sodium benzoate (Nut. Div.)
UNSPSC: Caffeine/sodium benzoate
Specifications / Requirementsss:
Sodium benzoate (Nut. Div.)Item: Sodium bicarbonate (Merck /Equivalent) (Nut. Div.)
UNSPSC: Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate
Specifications / Requirementsss:
Sodium bicarbonate (Merck /Equivalent) (Nut. Div.)Item: Sodium bisulfate (Merck /BDH) (Nut. Div.)
UNSPSC: Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate
Specifications / Requirementsss:
Sodium bisulfate (Merck /BDH) (Nut. Div.)Item: Sodium carbonate (Merck /BDH)
UNSPSC: Boric acid/potassium chloride/sodium carbonate
Specifications / Requirementsss:
Sodium carbonate (Merck /BDH)Item: Sodium Chloride (AR grade) Scharlau/ equivalent (Nut. Div.)
UNSPSC: Aminophylline/sodium chloride
Specifications / Requirementsss:
Sodium Chloride (AR grade) Scharlau/ equivalent (Nut. Div.)Item: Sodium chromate (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Sodium chromate (Nut. Div.)Item: Sodium hydroxide (Merck /BDH) (Nut. Div.)
UNSPSC: Sodium hydroxide
Specifications / Requirementsss:
Sodium hydroxide (Merck /BDH) (Nut. Div.)Item: Sodium sulphate (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Sodium sulphate (Nut. Div.)Item: Sodium thiosulphate (Merck /BDH) (Nut. Div.)
UNSPSC: Amyl nitrite/sodium nitrite/sodium thiosulfate
Specifications / Requirementsss:
Sodium thiosulphate (Merck /BDH) (Nut. Div.)Item: Sodium tungtate (Merck /BDH) (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Sodium tungtate (Merck /BDH) (Nut. Div.)Item: SPADNS, sodium 2-(parasulfophenylazo)-1,8-dihydroxy-3,6-naphthalene disulfonate, also called 4,5-dihydroxy-3-(parasulfophenylazo)-2,7 naphthalenedisulfonic acid trisodium salt (Nut. Div.)
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
SPADNS, sodium 2-(parasulfophenylazo)-1,8-dihydroxy-3,6-naphthalene disulfonate, also called 4,5-dihydroxy-3-(parasulfophenylazo)-2,7 naphthalenedisulfonic acid trisodium salt (Nut. Div.)Item: Standard/Calibrator each of Na, K, Ca (1000 ppm or 500 ppm) (Nut. Div.)
UNSPSC: Androgeny and fertility quality controls and calibrators and standards
Specifications / Requirementsss:
Standard/Calibrator each of Na, K, Ca (1000 ppm or 500 ppm) (Nut. Div.)Item: Starch soluble (AR grade) (Nut. Div.)
UNSPSC: Benzethonium chloride/corn starch/kaolin/zinc oxide
Specifications / Requirementsss:
Starch soluble (AR grade) (Nut. Div.)Item: Sucrose (Nut. Div.)
UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Specifications / Requirementsss:
Sucrose (Nut. Div.)Item: Sucrose (Merck /BDH) (Nut. Div.)
UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Specifications / Requirementsss:
Sucrose (Merck /BDH) (Nut. Div.)Item: Sulfate HANNA Instrument (Nut. Div.)
UNSPSC: Alcohol/sulfur/zinc oxide/zinc sulfate
Specifications / Requirementsss:
Sulfate HANNA Instrument (Nut. Div.)Item: Sulphate kit thermoscientific (Nut. Div.)
UNSPSC: Sodium thiosulfate or thiosulfate or thiosulphate
Specifications / Requirementsss:
Sulphate kit thermoscientific (Nut. Div.)Item: Sulphuric Acid (conc) (AR grade) (Merck / BDH). (Nut. Div.)
UNSPSC: Sulphuric acid
Specifications / Requirementsss:
Sulphuric Acid (conc) (AR grade) (Merck / BDH). (Nut. Div.)Item: Total Chlorine HANNA Instrument (Nut. Div.)
UNSPSC: Chlorine Cl
Specifications / Requirementsss:
Total Chlorine HANNA Instrument (Nut. Div.)Item: Tri chloro acetic acid (Nut. Div.)
UNSPSC: Acetic acid/benzalkonuim chloride/chloroxylenol/glycerin
Specifications / Requirementsss:
Tri chloro acetic acid (Nut. Div.)Item: Trifluoro Acetic Acid (AR grade) (Nut. Div.)
UNSPSC: 5-hydroxyindole acetic acid/serotonin test system
Specifications / Requirementsss:
Trifluoro Acetic Acid (AR grade) (Nut. Div.)Item: Urea (Merck /BDH) (Nut. Div.)
UNSPSC: Urea UF
Specifications / Requirementsss:
Urea (Merck /BDH) (Nut. Div.)Item: Zinc acetate (Merck /BDH) (Nut. Div.)
UNSPSC: Diphenhydramine/zinc acetate
Specifications / Requirementsss:
Zinc acetate (Merck /BDH) (Nut. Div.)Item: Zinc HANNA Instrument (Nut. Div.)
UNSPSC: Alcohol/benzoic acid/boric acid/zinc oxide/zinc stearate
Specifications / Requirementsss:
Zinc HANNA Instrument (Nut. Div.)Item: MacConkey agar purple CV (oxide eq) (Nut. Div.)
UNSPSC: Chemical or pharmaceutical machinery or equipment manufacture services
Specifications / Requirementsss:
MacConkey agar purple CV (oxide eq) (Nut. Div.)Item: Plate count agar (Nut. Div.)
UNSPSC: Polymerase chain reaction PCR tube strip and plate cooler
Specifications / Requirementsss:
Plate count agar (Nut. Div.)Item: Bismuth sulphite agar (Nut. Div.)
UNSPSC: Benzocaine/bismuth subgallate/phenylmecuric nitrate/zinc oxide
Specifications / Requirementsss:
Bismuth sulphite agar (Nut. Div.)Item: XLD agar (Nut. Div.)
UNSPSC: Agar-agar
Specifications / Requirementsss:
XLD agar (Nut. Div.)Item: Sabouraud Dextrose agar (Nut. Div.)
UNSPSC: Anticoagulant citrate phosphate dextrose solution
Specifications / Requirementsss:
Sabouraud Dextrose agar (Nut. Div.)Item: Simmons citrate agar (Nut. Div.)
UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Specifications / Requirementsss:
Simmons citrate agar (Nut. Div.)Item: Mannitol salt agar (Nut. Div.)
UNSPSC: Amifostine/mannitol
Specifications / Requirementsss:
Mannitol salt agar (Nut. Div.)Item: Nutrient agar (Nut. Div.)
UNSPSC: Nutrients
Specifications / Requirementsss:
Nutrient agar (Nut. Div.)Item: Tryptone soya agar (Nut. Div.)
UNSPSC: Tryptophan
Specifications / Requirementsss:
Tryptone soya agar (Nut. Div.)Item: Motility agar (Nut. Div.)
UNSPSC: Measurement of gastrointestinal motility, via natural or artificial opening
Specifications / Requirementsss:
Motility agar (Nut. Div.)Item: EMB agar (Nut. Div.)
UNSPSC: Agar-agar
Specifications / Requirementsss:
EMB agar (Nut. Div.)Item: TCBS agar (Nut. Div.)
UNSPSC: Agar-agar
Specifications / Requirementsss:
TCBS agar (Nut. Div.)Item: Peptone water (Nut. Div.)
UNSPSC: Water
Specifications / Requirementsss:
Peptone water (Nut. Div.)Item: MacConkey broth purple CV-3 (Nut. Div.)
UNSPSC: Mine action center MAC or mine action coordination center MACC service
Specifications / Requirementsss:
MacConkey broth purple CV-3 (Nut. Div.)Item: BGLB 20% (Nut. Div.)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
BGLB 20% (Nut. Div.)Item: MR-VP broth (Nut. Div.)
UNSPSC: Bottled broth media for bacteria
Specifications / Requirementsss:
MR-VP broth (Nut. Div.)Item: Hydrogen peroxide 30% (Nut. Div.)
UNSPSC: Carbamide peroxide or hydrogen peroxide
Specifications / Requirementsss:
Hydrogen peroxide 30% (Nut. Div.)Item: Kovac's reagent (Nut. Div.)
UNSPSC: Acid, alcohol, and decolorizing fluid reagents
Specifications / Requirementsss:
Kovac's reagent (Nut. Div.)Item: Oxidase reagent (Nut. Div.)
UNSPSC: Diagnosis of defects of catalase and peroxidase
Specifications / Requirementsss:
Oxidase reagent (Nut. Div.)Item: Emulsion oil (Nut. Div.)
UNSPSC: Emulsions
Specifications / Requirementsss:
Emulsion oil (Nut. Div.)Item: Barritt reagent-A (Nut. Div.)
UNSPSC: Acetic acid, alcohol, and toluidine blue combination reagents
Specifications / Requirementsss:
Barritt reagent-A (Nut. Div.)Item: Barritt reagent-B (Nut. Div.)
UNSPSC: Acetic acid, alcohol, and toluidine blue combination reagents
Specifications / Requirementsss:
Barritt reagent-B (Nut. Div.)Item: Methylated Spirit (Nut. Div.)
UNSPSC: Camphor/eucalyptus oil/menthol/turpentine spirits
Specifications / Requirementsss:
Methylated Spirit (Nut. Div.)Item: Catalase test (Sigma Aldrich) (CMLT)
UNSPSC: Diagnosis of defects of catalase and peroxidase
Specifications / Requirementsss:
Catalase test (Sigma Aldrich) (CMLT)Item: Oxidase test (Biomerieux) (CMLT)
UNSPSC: Leukocyte peroxidase test
Specifications / Requirementsss:
Oxidase test (Biomerieux) (CMLT)Item: Ziehl Neelsen (Diacheme) (CMLT)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Ziehl Neelsen (Diacheme) (CMLT)Item: Field Stain set(Diacheme) (CMLT)
UNSPSC: Field strength measuring equipment
Specifications / Requirementsss:
Field Stain set(Diacheme) (CMLT)Item: Spirit Lamp (CMLT)
UNSPSC: Camphor/eucalyptus oil/menthol/turpentine spirits
Specifications / Requirementsss:
Spirit Lamp (CMLT)Item: Disposable gloves (Nylon) (CMLT)
UNSPSC: Chemical resistant gloves
Specifications / Requirementsss:
Disposable gloves (Nylon) (CMLT)Item: HCV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HCV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HBs Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HBs Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HBs Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HBs Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HBe Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HBe Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HBe Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HBe Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)Item: HBc IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6-12 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HBc IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6-12 months CE-IVD/FDA approved 96 test (PHLD)Item: HB core IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HB core IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HAV Ab IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HAV Ab IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HEV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
HEV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Toxoplasma IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Basic Diagnostic Procedures
Specifications / Requirementsss:
Toxoplasma IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Toxoplasma IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6-12 months\ CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnosis of toxoplasma hepatitis
Specifications / Requirementsss:
Toxoplasma IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6-12 months\ CE-IVD/FDA approved 96 test (PHLD)Item: Rubella IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnoses of rubella without complication
Specifications / Requirementsss:
Rubella IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Rubella IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnoses of rubella without complication
Specifications / Requirementsss:
Rubella IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: CMV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
CMV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)Item: CMV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
CMV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HSV IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
HSV IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved (PHLD)Item: HSV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
HSV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Measles IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnoses of measles complicated by encephalitis
Specifications / Requirementsss:
Measles IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Measles IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnoses of measles complicated by encephalitis
Specifications / Requirementsss:
Measles IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Mumps IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnoses of mumps pancreatitis
Specifications / Requirementsss:
Mumps IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Mumps IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnoses of mumps pancreatitis
Specifications / Requirementsss:
Mumps IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: VZV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
VZV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: VZV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
VZV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: EBV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
EBV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: HIV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
HIV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Rabies Ab titer, Biorad/equivalent Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)
UNSPSC: Diagnosis of sylvatic rabies
Specifications / Requirementsss:
Rabies Ab titer, Biorad/equivalent Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)Item: Dengue Virus IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)
UNSPSC: Diagnosis of dengue haemorrhagic fever
Specifications / Requirementsss:
Dengue Virus IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)Item: Dengue Virus IgG ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)
UNSPSC: Diagnosis of dengue haemorrhagic fever
Specifications / Requirementsss:
Dengue Virus IgG ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)Item: Dengue Virus NS1 ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved. Detection of suspected target organism should be in one well 96 test
UNSPSC: Diagnoses of dengue fever or classical dengue
Specifications / Requirementsss:
Dengue Virus NS1 ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved. Detection of suspected target organism should be in one well 96 testItem: Dengue Virus IgG/IgM and NS1, Combo Rapid Test Kit(Qualitative) Should include all reagents Shelf life 6-12 months CE-IVD/FDA approved 25 test (PHLD)
UNSPSC: Diagnoses of dengue fever or classical dengue
Specifications / Requirementsss:
Dengue Virus IgG/IgM and NS1, Combo Rapid Test Kit(Qualitative) Should include all reagents Shelf life 6-12 months CE-IVD/FDA approved 25 test (PHLD)Item: West Nile Fever Virus IgM ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)
UNSPSC: Diagnosis of west nile virus infection
Specifications / Requirementsss:
West Nile Fever Virus IgM ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)Item: Japanese Encephalitis IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)
UNSPSC: Diagnoses of australian encephalitis
Specifications / Requirementsss:
Japanese Encephalitis IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)Item: Mpox Virus Realtime-PCR Kit (Qualitative) positive and negative control, Must Detect both Clades (I &II) Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 48 test (PHLD)
UNSPSC: Diagnosis of acute bronchiolitis due to human metapneumovirus
Specifications / Requirementsss:
Mpox Virus Realtime-PCR Kit (Qualitative) positive and negative control, Must Detect both Clades (I &II) Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 48 test (PHLD)Item: CCHFV Realtime-PCR Kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
CCHFV Realtime-PCR Kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)Item: Triplex Realtime-PCR kit for Dengue, Chikungunya & Zika Virus Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)
UNSPSC: Triplex pumps
Specifications / Requirementsss:
Triplex Realtime-PCR kit for Dengue, Chikungunya & Zika Virus Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)Item: Oropouche Virus Real Time PCR kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA/RUO approved For Human Specimen 96 test (PHLD)
UNSPSC: Diagnoses of oropouche virus disease
Specifications / Requirementsss:
Oropouche Virus Real Time PCR kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA/RUO approved For Human Specimen 96 test (PHLD)Item: Filo Virus Realtime-PCR Kits (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)
UNSPSC: Butofilolol
Specifications / Requirementsss:
Filo Virus Realtime-PCR Kits (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)Item: West Nile Fever Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)
UNSPSC: Diagnosis of west nile virus infection
Specifications / Requirementsss:
West Nile Fever Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)Item: Varicella-Zoster Virus Realtime-PCR Kit (Qualitative) positive and negative control shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)
UNSPSC: Diagnosis of disseminated zoster
Specifications / Requirementsss:
Varicella-Zoster Virus Realtime-PCR Kit (Qualitative) positive and negative control shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)Item: CMV Real Time PCR kit (Qualitative) positive and negative control: Shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test. (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
CMV Real Time PCR kit (Qualitative) positive and negative control: Shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test. (PHLD)Item: HSV Real Time Kit (Qualitative) Must Identify HSV-1 and HSV-2 in single reaction positive and negative control shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen 96 test (PHLD)
UNSPSC: Oilfield real time well data monitoring services
Specifications / Requirementsss:
HSV Real Time Kit (Qualitative) Must Identify HSV-1 and HSV-2 in single reaction positive and negative control shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen 96 test (PHLD)Item: Rabies Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)
UNSPSC: Rabies vaccine
Specifications / Requirementsss:
Rabies Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)Item: Realtime-PCR Kit of Hepatitis B Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included
UNSPSC: Oilfield real time well data monitoring services
Specifications / Requirementsss:
Realtime-PCR Kit of Hepatitis B Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved 96 test (PHLD)Item: Realtime-PCR Kit of Hepatitis C Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved\ I
UNSPSC: Oilfield real time well data monitoring services
Specifications / Requirementsss:
Realtime-PCR Kit of Hepatitis C Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved\ Internal Control: Included 96 test (PHLD)Item: Trioplex Realtime -PCR Kit for SARS-CoV-2, Flu A & B, RSV, Target Pathogens: SARS-CoV-2, Influenza A (including H1N1 and H3N2), Influenza B, Respiratory Syncytial Virus (RSV A/B) Specimen Type: Nasopharyngeal swabs, oropharyngeal swabs Internal Cont
UNSPSC: Oilfield real time well data monitoring services
Specifications / Requirementsss:
Trioplex Realtime -PCR Kit for SARS-CoV-2, Flu A & B, RSV, Target Pathogens: SARS-CoV-2, Influenza A (including H1N1 and H3N2), Influenza B, Respiratory Syncytial Virus (RSV A/B) Specimen Type: Nasopharyngeal swabs, oropharyngeal swabs Internal Control: Included, Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved 96 test (PHLD)Item: Positive Control for Oropouche Virus Type: Inactivated virus / Plasmid control Form: Lyophilized Purpose: Use as a positive control in molecular diagnostic assays (e.g., real-time RT-PCR, conventional RT-PCR) for OROV Volume: Minimum 100µL per via
UNSPSC: Diagnoses of oropouche virus disease
Specifications / Requirementsss:
Positive Control for Oropouche Virus Type: Inactivated virus / Plasmid control Form: Lyophilized Purpose: Use as a positive control in molecular diagnostic assays (e.g., real-time RT-PCR, conventional RT-PCR) for OROV Volume: Minimum 100µL per vial 100 Ul (PHLD)Item: MAYV_FNF, 5’-CACGGACMTTTTGCCTTCA 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
MAYV_FNF, 5’-CACGGACMTTTTGCCTTCA 50nm DeSalt (PHLD)Item: MAYV_FNR, 5’-AGACTGCCACCTCTGCTKGAG 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
MAYV_FNR, 5’-AGACTGCCACCTCTGCTKGAG 50nm DeSalt (PHLD)Item: MAYV_FNP, 5’-VIC-ACAGATCAGACATGCAGG-NFQ-MGB 200nm HPLC (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
MAYV_FNP, 5’-VIC-ACAGATCAGACATGCAGG-NFQ-MGB 200nm HPLC (PHLD)Item: OROV_FNF,5’-TCCGGAGGCAGCATATGTG 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
OROV_FNF,5’-TCCGGAGGCAGCATATGTG 50nm DeSalt (PHLD)Item: OROV_FNR, 5’-ACAACACCAGCATTGAGCACTT 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
OROV_FNR, 5’-ACAACACCAGCATTGAGCACTT 50nm DeSalt (PHLD)Item: OROV_FNP, 5’-FAM-CATTTGAAGCTAGATACGG-NFQ-MGB 200nm HPLC (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
OROV_FNP, 5’-FAM-CATTTGAAGCTAGATACGG-NFQ-MGB 200nm HPLC (PHLD)Item: NF5,TGAGTGCTCTCCAACTTCTGCAGT 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
NF5,TGAGTGCTCTCCAACTTCTGCAGT 50nm DeSalt (PHLD)Item: NR5,TTCTTCAGAGCTTGCATCTTGAT 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
NR5,TTCTTCAGAGCTTGCATCTTGAT 50nm DeSalt (PHLD)Item: PF1,TTTAATCGACATGGGAGCAATTG 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
PF1,TTTAATCGACATGGGAGCAATTG 50nm DeSalt (PHLD)Item: PR1, TAAGGTGGGTCAGACGGAGAGA 50nm DeSalt (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
PR1, TAAGGTGGGTCAGACGGAGAGA 50nm DeSalt (PHLD)Item: TaqMan MGB Probe, VIC-AGAATTCATCCTGGCAGCT-NFQ 200 nm HPLC (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
TaqMan MGB Probe, VIC-AGAATTCATCCTGGCAGCT-NFQ 200 nm HPLC (PHLD)Item: RA Factor Latex 100 tests(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
RA Factor Latex 100 tests(PHLD)Item: CRP Latex 100 tests(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
CRP Latex 100 tests(PHLD)Item: Anti IgA Ab ( Manual Elisa )(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
Anti IgA Ab ( Manual Elisa )(PHLD)Item: Anti CCP IgGAb ( Manual Elisa)(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
Anti CCP IgGAb ( Manual Elisa)(PHLD)Item: ANA IgG kit Elisa (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
ANA IgG kit Elisa (PHLD)Item: BrucellaAb Latex 100 tests(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
BrucellaAb Latex 100 tests(PHLD)Item: ASO Titter Latex 100 tests(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
ASO Titter Latex 100 tests(PHLD)Item: ICT MP Devices(PHLD)
UNSPSC: Altitude measuring devices
Specifications / Requirementsss:
ICT MP Devices(PHLD)Item: Anti TTG IgG Elisa Manual(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
Anti TTG IgG Elisa Manual(PHLD)Item: Anti DeaminatedgladinAb ( Elisa ) DGP IgG(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
Anti DeaminatedgladinAb ( Elisa ) DGP IgG(PHLD)Item: H Pylori for stool Antigen Devices (PHLD)
UNSPSC: Diagnosis of adult hypertrophic pyloric stenosis
Specifications / Requirementsss:
H Pylori for stool Antigen Devices (PHLD)Item: Total Immunoglobulin A Elisa kit(PHLD)
UNSPSC: Bacterial immunoglobulins
Specifications / Requirementsss:
Total Immunoglobulin A Elisa kit(PHLD)Item: VDRL Latex kit 100 tests(PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
VDRL Latex kit 100 tests(PHLD)Item: H Pylori IgM Antibodies Elisa kit 96 tests(PHLD)
UNSPSC: Diagnosis of adult hypertrophic pyloric stenosis
Specifications / Requirementsss:
H Pylori IgM Antibodies Elisa kit 96 tests(PHLD)Item: Urine Pregnancy Kit (PHLD)
UNSPSC: The diagnosis of extravasation of urine
Specifications / Requirementsss:
Urine Pregnancy Kit (PHLD)Item: Occult Blood Kit (PHLD)
UNSPSC: Occult blood test
Specifications / Requirementsss:
Occult Blood Kit (PHLD)Item: Streptococcus grouping kit (Thermo) (PHLD)
UNSPSC: Diagnosis of acute bronchitis due to streptococcus
Specifications / Requirementsss:
Streptococcus grouping kit (Thermo) (PHLD)Item: G6PD Test Kit (Qualitative Method) (Span Diagnostics, France) (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
G6PD Test Kit (Qualitative Method) (Span Diagnostics, France) (PHLD)Item: ABO Blood Grouping Kit, (Atlas Medical, Germany) (03x10ml/kit) (PHLD)
UNSPSC: Kits or enzymes for sequencing
Specifications / Requirementsss:
ABO Blood Grouping Kit, (Atlas Medical, Germany) (03x10ml/kit) (PHLD)Item: Absolute ethanol, molecular biology grade (2.5 liter Pack) (PHLD)
UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Specifications / Requirementsss:
Absolute ethanol, molecular biology grade (2.5 liter Pack) (PHLD)Item: Sodium hypochlorite Solution) 100% (PHLD)
UNSPSC: Benzalkonium chloride/edetate/sodium hydroxide
Specifications / Requirementsss:
Sodium hypochlorite Solution) 100% (PHLD)Item: Medium RPMI 1640 (!X) Without L-Glutamine Ref No 21870-076, Lot No. 2518007 Gibco company 500 ml (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Medium RPMI 1640 (!X) Without L-Glutamine Ref No 21870-076, Lot No. 2518007 Gibco company 500 ml (PHLD)Item: Phytohaemagglutinin (PHA)- CAT No. 151884-MP Biomedicals, LLC (Pack of 10mg)(PHLD)
UNSPSC: Phytotron
Specifications / Requirementsss:
Phytohaemagglutinin (PHA)- CAT No. 151884-MP Biomedicals, LLC (Pack of 10mg)(PHLD)Item: Fetal Bovine Serum (FBS) (Pack of 100 ml) (PHLD)
UNSPSC: Bovine semen
Specifications / Requirementsss:
Fetal Bovine Serum (FBS) (Pack of 100 ml) (PHLD)Item: Penicillin Streptomycin (PSS) ICN/ Sigma /Equivalent (Pack of 100 ml) (PHLD)
UNSPSC: Adicillin or penicillin n
Specifications / Requirementsss:
Penicillin Streptomycin (PSS) ICN/ Sigma /Equivalent (Pack of 100 ml) (PHLD)Item: L-Glutamine (ICN, Cat No. 16-801049) (Pack of 100 ml) (PHLD)
UNSPSC: Glutamine
Specifications / Requirementsss:
L-Glutamine (ICN, Cat No. 16-801049) (Pack of 100 ml) (PHLD)Item: Ethanol (Merck/BDH/Equal) (Pack of 2.5 lit)
UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Specifications / Requirementsss:
Ethanol (Merck/BDH/Equal) (Pack of 2.5 lit)Item: Methanol (Merck/BDH/Equal) (Pack of 2.5 lit) (PHLD)
UNSPSC: Methanol
Specifications / Requirementsss:
Methanol (Merck/BDH/Equal) (Pack of 2.5 lit) (PHLD)Item: Glycerin (Pack of 2.5 lit)(PHLD)
UNSPSC: Acetic acid/antipyrine/benzocaine/glycerin
Specifications / Requirementsss:
Glycerin (Pack of 2.5 lit)(PHLD)Item: Acetic Acid Ct No 40766363-Merk (Pack of 2.5 lit) (PHLD)
UNSPSC: Acetic acid
Specifications / Requirementsss:
Acetic Acid Ct No 40766363-Merk (Pack of 2.5 lit) (PHLD)Item: Nuclease free water Invitrogen Ultra Pure Distilled Water Dnase/RNase free (500ml) (PHLD)
UNSPSC: Chloramphenicol/desoxyribonuclease/fibrinolysin
Specifications / Requirementsss:
Nuclease free water Invitrogen Ultra Pure Distilled Water Dnase/RNase free (500ml) (PHLD)Item: Absolute Ethanol (2.5L) (PHLD)
UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Specifications / Requirementsss:
Absolute Ethanol (2.5L) (PHLD)Item: PCR Tubes with strips (0.2ml) thin walled PCR Tubes strip with indidual flat cap Dnase,RNase and pyrogen free 120 strip/Pack NEST Biotechnology (PHLD)
UNSPSC: Polymerase chain reaction PCR tube strip and plate cooler
Specifications / Requirementsss:
PCR Tubes with strips (0.2ml) thin walled PCR Tubes strip with indidual flat cap Dnase,RNase and pyrogen free 120 strip/Pack NEST Biotechnology (PHLD)Item: Anaerobic gas pack( pack of 10) (PHLD)
UNSPSC: Anaerobic jars or accessories
Specifications / Requirementsss:
Anaerobic gas pack( pack of 10) (PHLD)Item: Potassium hydroxide (PHLD)
UNSPSC: Potassium hydroxide
Specifications / Requirementsss:
Potassium hydroxide (PHLD)Item: Potassium Tellurite`
UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Specifications / Requirementsss:
Potassium Tellurite`Item: (HCL) concentrated (PHLD)
UNSPSC: Bisacodyl/docusate/senna concentrate/senna extract/sucrose
Specifications / Requirementsss:
(HCL) concentrated (PHLD)Item: Hydrogen Peroxide (PHLD)
UNSPSC: Carbamide peroxide or hydrogen peroxide
Specifications / Requirementsss:
Hydrogen Peroxide (PHLD)Item: Glycerin (Glycerol) 87%, Merck (Pack of 2.5) (PHLD)
UNSPSC: Acetic acid/antipyrine/benzocaine/glycerin
Specifications / Requirementsss:
Glycerin (Glycerol) 87%, Merck (Pack of 2.5) (PHLD)Item: Hand Disinfectant/ Antiseptic (PHLD)
UNSPSC: Dialysate delivery system disinfectants
Specifications / Requirementsss:
Hand Disinfectant/ Antiseptic (PHLD)Item: Hypochlorite (KOSDAQ ) 6-14% (PHLD)
UNSPSC: Sodium hypochlorite
Specifications / Requirementsss:
Hypochlorite (KOSDAQ ) 6-14% (PHLD)Item: Culti Loops Thermofisher or equivalent ATCC 49226 Neisseria gonorrhoeae (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Culti Loops Thermofisher or equivalent ATCC 49226 Neisseria gonorrhoeae (PHLD)Item: Culti Loops Thermofisher or equivalent ATCC 43300 S. aureus methicillin resistant control (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Culti Loops Thermofisher or equivalent ATCC 43300 S. aureus methicillin resistant control (PHLD)Item: Culti Loops Thermofisher or equivalent ATCC 27853Peudomonasaeruginosa (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Culti Loops Thermofisher or equivalent ATCC 27853Peudomonasaeruginosa (PHLD)Item: Culti Loops Thermofisher or equivalent ATCC 25922 E.coli (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Culti Loops Thermofisher or equivalent ATCC 25922 E.coli (PHLD)Item: Culti Loops Thermofisher or equivalent ATCC 19615 S.pyogenes (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Culti Loops Thermofisher or equivalent ATCC 19615 S.pyogenes (PHLD)Item: Culti Loops Thermofisher or equivalent ATCC 27012 C. diphtheria (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Culti Loops Thermofisher or equivalent ATCC 27012 C. diphtheria (PHLD)Item: Culti Loops Thermofisher or equivalent ATCC 27010 C. diphtheria (PHLD)
UNSPSC: Industrial chemical equipment spare parts and accessories
Specifications / Requirementsss:
Culti Loops Thermofisher or equivalent ATCC 27010 C. diphtheria (PHLD)Item: Bovine Albumin 22 %(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)
UNSPSC: Bovine production services
Specifications / Requirementsss:
Bovine Albumin 22 %(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)Item: Anti-Human Globulin(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)
UNSPSC: Alpha-2-macroglobulin immunological test system
Specifications / Requirementsss:
Anti-Human Globulin(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)Item: Hand Sanitizer (liquid)(OROSEPT Solution) ( Pack of 500ml) (PHLD)
UNSPSC: Hand sanitizer
Specifications / Requirementsss:
Hand Sanitizer (liquid)(OROSEPT Solution) ( Pack of 500ml) (PHLD)Item: Immersion Oil for Microscopy, (Sigma-Aldrich Co., USA) ( Pack of500ml) (PHLD)
UNSPSC: Microscope immersion oil
Specifications / Requirementsss:
Immersion Oil for Microscopy, (Sigma-Aldrich Co., USA) ( Pack of500ml) (PHLD)Item: Reticulocyte Count Stain ( Pack of 100 ml) (Diachem ) (PHLD)
UNSPSC: Diagnosis of actinic reticuloid
Specifications / Requirementsss:
Reticulocyte Count Stain ( Pack of 100 ml) (Diachem ) (PHLD)Item: Giemsa Stain (Pack of 1000ml) (Merck, KGaA, Germany) (PHLD)
UNSPSC: Alloy steel/stainless steel check valve
Specifications / Requirementsss:
Giemsa Stain (Pack of 1000ml) (Merck, KGaA, Germany) (PHLD)Item: Spirit (PHLD)
UNSPSC: Spirits or liquors
Specifications / Requirementsss:
Spirit (PHLD)Price Schedule
For Individual Items
| # | Item Title | Quantity | Unit Price (PKR) | Total Price (PKR) | Delivery Location | Delivery Period / Year | Country of Origin |
|---|---|---|---|---|---|---|---|
| 1 | |||||||
| 2 |
| # | Lot Title | Total Lot Price (PKR) | Country of Origin |
|---|---|---|---|
| 1 | [Lot 1 Title] |
📑 General Conditions of Contract (GCC)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
A. General
1. Definitions
1.1 Unless the context otherwise requires, the following terms whenever used in this Contract shall have the same meaning and shall be interpreted as indicated
- “Applicable Law” means the laws and any other instruments having the force of law in the Government’s Country, or in such other country as may be specified in the Special Conditions of the Contract (SC), as they may be issued and in force from time to time;
- “Procuring Agency” means:-
- any Ministry, Division, Department or any Office of the Government;
- any authority, corporation, body or organization established by or under a Law or which is owned or controlled by the Government;.
- “The Contract” means an agreement enforceable by law;
- “The Contract Price” means the price payable to the Bidder under the Contract for the full and proper performance of its contractual obligations;
- “Ancillary Services” means those services ancillary to the provision of Goods, such as transportation and insurance, and any other incidental services, such as installation, commissioning, provision of technical assistance, training, and other such obligations of the Bidder covered under the Contract;
- “GCC” means the General Conditions of Contract contained in this section;
- “SCC” means the Special Conditions of Contract by which the GCC may be amended or supplemented;
- “Day” means calendar day unless indicated otherwise.
- “Effective Date” means the date on which this Contract comes into force and effect.
- The Bidder” means the individual or corporate body whose Bids to provide the Goods has been accepted by the Procuring Agency;
- “The Project Site,” where applicable, means the place or places named in Bids Data Sheet and technical Specifications;
- “Government” means the Government of Pakistan;
- “Subcontractor” means any entity to which the Bidder subcontracts any part of the Goods.
- "Service" means any object of procurement other than goods or works;
- “Party” means the Procuring Agency or the Bidder, as the case may be, and “Parties” means both of them;
- “Foreign Currency” means any currency other than the currency of the country of the Procuring Agency;
- “Completion Date” means the date of completion of the contract by the Bidder as certified by the Procuring Agency;
- “In Writing” means communicated in written form with proof of receipt;
- “Local Currency” means the currency of Pakistan;
2. Application and Interpretation
2.1 These General Conditions shall apply to the extent that they are not superseded by provisions of other parts of the Contract.
2.2 In interpreting these Conditions of Contract headings and marginal notes are used for convenience only and shall not affect their interpretations unless specifically stated; references to singular include the plural and vice versa; and masculine include the feminine. Words have their ordinary meaning under the language of the Contract unless specifically defined.
3. Applicable Law
3.1 The contract shall be governed and interpreted in accordance with the laws of Pakistan, unless otherwise specified in SCC.
4. Governing Language
4.1 The Contract as well as all correspondence and documents relating to the Contract exchanged between the Bidder and the Procuring Agency, shall be written in the English language unless otherwise stated in the SCC. Supporting documents and printed literature that are part of the Contract may be in another language provided these are accompanied by an accurate translation of the relevant passages in English, in which case, for purposes of interpretation of the Contract, this translation shall govern.
5. Notices
5.1 Any notice, request, or consent made pursuant to this Contract shall be in writing and shall be deemed to have been made when delivered in person to an authorized representative of the Party to whom the communication is addressed, or when sent by registered mail, telex, telegram, or facsimile to such Party at the address specified in the SCC.
6. Delivery/Location
6.1 The Goods shall be delivered to such locations as the Procuring Agency may approve and as specified in SCC.
7. Authorized Representatives / Authority of Member in charge
7.1 Any action required or permitted to be taken, and any document required or permitted to be executed, under this Contract by the Procuring Agency or the Bidder may be taken or executed by the officials specified in the SCC.
B. Commencement, Completion, Modification, and Termination of Contract
8. Effectiveness of Contract
8.1 This Contract shall come into effect on the date the Contract is signed by both parties and such other later date as may be stated in the SCC.
9. Commencement of Services
9.1 The Bidder shall confirm availability of Key Experts and begin carrying out the Services not later than the number of days after the Effective Date specified in the SCC.
10. Program
10.1 Before commencement of the Services, the Bidder shall submit to the Procuring Agency for approval a Program showing the general methods, arrangements, order and timing for all activities. The Services shall be carried out in accordance with the approved Program as updated.
11. Starting Date/Expiration Date
11.1 The Bidder shall start carrying out the Services Five (05) days after the date the Contract becomes effective, or at such other date as may be specified in the SCC.
11.2 Unless terminated earlier pursuant to Clause GCC 15 hereof, this Contract shall expire at the end of such time period after the Effective Date as specified in the SCC.
12. Entire Agreement
12.1 This Contract contains all covenants, stipulations and provisions agreed by the Parties. No agent or representative of either Party has authority to make, and the Parties shall not be bound by or be liable for, any statement, representation, promise or agreement not set forth herein.
13. Modification
13.1 Any modification or variation of the terms and conditions of this Contract, including any modification or variation of the scope of the Services, may only be made by written agreement between the Parties. However, each Party shall give due consideration to any Bids for modification or variation made by the other Party.
13.2 In cases of any modifications or variations, the prior written consent of the Procuring Agency is required.
14. Force Majeure
14.1 Definition
For the purposes of this Contract, “Force Majeure” means an event which is beyond the reasonable control of a Party and which makes a Party’s performance of its obligations under the Contract impossible or so impractical as to be considered impossible under the circumstances.
14.2 No Breach of Contract
The failure of a Party to fulfill any of its obligations under the contract shall not be considered to be a breach of, or default under, this Contract in so far as such inability arises from an event of Force Majeure, provided that the Party affected by such an event (a) has taken all reasonable precautions, due care and reasonable alternative measures in order to carry out the terms and conditions of this Contract, and (b) has informed the other Party as soon as possible about the occurrence of such an event.
14.3 Extension of Time
Any period within which a Party shall, pursuant to this Contract, complete any action or task, shall be extended for a period equal to the time during which such Party was unable to perform such action as a result of Force Majeure.
14.4 Payments
During the period of their inability to perform the Services as a result of an event of Force Majeure, the Bidder shall be entitled to continue to be paid under the terms of this Contract, as well as to be reimbursed for additional costs reasonably and necessarily incurred by them during such period for the purposes of the Services and in reactivating the Service after the end of such period.
15. Termination
15.1 By the Procuring Agency
The Procuring Agency may terminate this Contract in case of the occurrence of any of the events specified in paragraphs (a) through (e) of this Clause. In such an occurrence the Procuring Agency shall give at least thirty (30) calendar days’ written notice of termination to the Bidder in case of the events referred to in (a) through (d); at least sixty (60) calendar days’ written notice in case of the event referred to in (e);
- If the Bidder fails to remedy a failure in the performance of its obligations hereunder, as specified in a notice of suspension;
- If the Bidder becomes (or, if the Bidder consists of more than one entity, if any of its members becomes) insolvent or bankrupt or enter into any agreements with their creditors for relief of debt or take advantage of any law for the benefit of debtors or go into liquidation or receivership whether compulsory or voluntary;
- If the Bidder fails to comply with any final decision reached as a result of arbitration proceedings;
- If, as the result of Force Majeure, the Bidder is unable to perform a material portion of the Services for a period of not less than sixty (60) calendar days;
- If the Procuring Agency, in its sole discretion and for any reason whatsoever, decides to terminate this Contract;
15.2 By the Bidder
The Bidder may terminate this Contract, by not less than thirty (30) calendar days’ written notice to the Procuring Agency, in case of the occurrence of any of the events specified in paragraphs (a) through (d) of this Clause.
- If the Procuring Agency fails to pay any money due to the Bidder pursuant to this Contract and not subject to dispute within forty-five (45) calendar days after receiving written notice from the Bidder that such payment is overdue.
- If, as the result of Force Majeure, the Bidder is unable to perform a material portion of the Services for a period of not less than sixty (60) calendar days.
- If the Procuring Agency fails to comply with any final decision reached as a result of arbitration.
- If the Procuring Agency is in material breach of its obligations pursuant to this Contract and has not remedied the same within forty-five (45) days (or such longer period as the Bidder may have subsequently approved in writing) following the receipt by the Procuring Agency of the Bidder’s notice specifying such breach.
C. Obligations of the Bidder
16. General
16.1 Standard of Performance
- The Bidder shall deliver the product and carry out the Services with all due diligence, efficiency and economy, in accordance with generally accepted professional standards and practices, and shall observe sound management practices, and employ appropriate technology and safe and effective equipment, machinery, materials and methods. The Bidder shall always act, in respect of any matter relating to this Contract or to the Services, as a faithful adviser to the Procuring Agency, and shall at all times support and safeguard the Procuring Agency’s legitimate interests in any dealings with the third parties.
16.2 Law Applicable to Goods
The Bidder shall deliver the goods in accordance with the Contract and in accordance with the Law of Pakistan and shall take all practicable steps to ensure that any of its Experts and Sub-Bidders, comply with the Applicable Law.
17. Conflict of Interests
17.1 Bidder Not to Benefit from Commissions and Discounts.
The remuneration of the Bidder shall constitute the Bidder’s sole remuneration in connection with this Contract or the Services, and the Bidder shall not accept for their own benefit any trade commission, discount, or similar payment in connection with activities pursuant to this Contract or to the Services or in the discharge of their obligations under the Contract, and the Bidder shall use their best efforts to ensure that the Personnel, any Subcontractors, and agents of either of them similarly shall not receive any such additional remuneration.
17.2 Bidder and Affiliates Not to be Otherwise Interested in Project
The Bidder agree that, during the term of this Contract and after its termination, the Bidder and its affiliates, as well as any Subcontractor and any of its affiliates, shall be disqualified from providing Goods for any project resulting from or closely related to the Services.
17.3 Prohibition of Conflicting Activities
Neither the Bidder nor its Subcontractors nor the Personnel shall engage, either directly or indirectly, in any of the following activities:
- during the term of this Contract, any business or professional activities in the Government’s country which would conflict with the activities assigned to them under this Contract;
- during the term of this Contract, neither the Bidder nor their Subcontractors shall hire public employees in active duty or on any type of leave, to perform any activity under this Contract;
18. Confidentiality
18.1 Except with the prior written consent of the Procuring Agency, the Bidder and the Experts shall not at any time communicate to any person or entity any confidential information acquired in the course of the contract.
19. Insurance to be Taken Out by the Bidder
19.1 The Bidder(a) shall take out and maintain, and shall cause any Subcontractors to take out and maintain, at its (or the Subcontractors’, as the case may be) own cost but on terms and conditions approved by the Procuring Agency, insurance against the risks, loss or damage, and for the coverage, as shall be specified in the SCC; and (b) at the Procuring Agency’s request, shall provide evidence to the Procuring Agency showing that such insurance has been taken out and maintained and that the current premiums have been paid.
20. Bidder’s Actions Requiring Procuring Agency’s Prior Approval
20.1 The Bidder shall obtain the Procuring Agency’s prior approval in writing before taking any of the following actions:
(a) appointing such members of the Personnel not provided by the Bidder;
(b) changing the Program of activities; and
(c) any other action that may be specified in the SCC.
21. Reporting Obligations
21.1 The Bidder shall submit to the Procuring Agency the reports and documents in the numbers, and within the periods as prescribed by the Procuring Agency.
22. Liquidated Damages
22.1 If the Supplier fails to deliver any or all of the Goods or to perform the Services within the period(s) specified in the Contract, the Procuring Agency shall, without prejudice to its other remedies under the Contract, deduct from the Contract Price, as liquidated damages, a sum equivalent to the percentage specified in SCC of the delivered price of the delayed Goods or unperformed Services for each week or part thereof of delay until actual delivery or performance, up to a maximum deduction of the performance security (or guarantee) specified in SCC. Once the said maximum is reached, the Procuring Agency may consider termination of the Contract pursuant to GCC Clause 15.
22.2 Correction for Over-payment
If the Intended Completion Date is extended after liquidated damages have been paid, the Procuring Agency shall correct any overpayment of liquidated damages by the Bidder by adjusting the next payment certificate. The Bidder shall be paid interest on the overpayment, calculated from the date of payment to the date of repayment, at the rates specified in SCC.
22.3 Lack of performance penalty
If the Bidder has not corrected a Defect within the time specified in the Procuring Agency’s notice, a penalty for Lack of performance will be paid by the Bidder. The amount to be paid will be calculated as a percentage of the cost of having the Defect corrected, assessed as specified in the SCC.
23. Performance Guarantee
23.1 Within Seven (07) days from the issuance of acceptance letter from the Procuring Agency, the successful Bidder shall furnish the Performance Guarantee in shape of ------- at the discretion of the PA in the amount specified in SCC. In case the amount of Bids security is equal or greater than
23.2 The proceeds of the Performance Guarantee shall be payable to the Procuring agency as compensation for any loss resulting from the Supplier’s failure to complete its obligations under the Contract.
23.3 The Performance Guarantee shall be denominated in the currency of the Contract, or in a freely convertible currency acceptable to the Procuring agency and shall be in the acceptable form as specified in SCC.
23.4 The Performance Guarantee will be discharged by the Procuring agency and returned to the Supplier not later than thirty (30) days following the date of completion of the Supplier’s performance obligations under the Contract, including any warranty obligations, unless otherwise specified in SCC.
24. Fraud and Corruption
24.1 The Procuring Agency requires the Supplier to disclose any commissions or fees that may have been paid or are to be paid to agents or any other party with respect to the Bidding process or execution of the Contract. The information disclosed must include at least the name and address of the agent or other party, the amount and currency, and the purpose of the commission, gratuity or fee.
25. Sustainable Procurement
25.1 The Bidder shall conform to the sustainable procurement contractual provisions, if and as specified in the SCC.
D. Bidder’s Personnel
26. Description of Personnel
26.1 The titles, agreed job descriptions, minimum qualifications, and estimated periods of engagement in the carrying out of the Services of the Bidder’s Key Personnel. The Key Personnel listed by title as well as by name are hereby approved by the Procuring Agency.
27. Removal and/or Replacement of Personnel
27.1 Except as the Procuring Agency may otherwise agree, no changes shall be made in the Key Personnel. If, for any reason beyond the reasonable control of the Bidder, it becomes necessary to replace any of the Key Personnel, the Bidder shall provide as a replacement a person of equivalent or better qualifications.
27.2 If the Procuring Agency finds that any of the Personnel have (i) committed serious misconduct or have been charged with having committed a criminal action, or (ii) have reasonable cause to be dissatisfied with the performance of any of the Personnel, then the Bidder shall, at the Procuring Agency’s written request specifying the grounds thereof, provide as a replacement a person with qualifications and experience acceptable to the Procuring Agency.
27.3 The Bidder shall have no claim for additional costs arising out of or incidental to any removal and/or replacement of Personnel.
E. Obligations of the Procuring Agency
28. Assistance and Exemptions
28.1 The Procuring Agency shall use its best efforts to ensure that the Government shall provide the Bidder such assistance and exemptions as specified in the SCC.
29. Change in the Applicable Law
29.1 If, after the date of this Contract, there is any change in the Applicable Law with respect to taxes and duties which increases or decreases the cost of the related Services rendered by the Bidder, then the remuneration and reimbursable expenses otherwise payable to the Bidder under this Contract shall be increased or decreased accordingly by agreement between the Parties, and corresponding adjustments shall be made to the amounts referred in the SCC.
30. Services and Facilities
30.1 The Procuring Agency shall make available to the Bidder and the Experts, for the purposes of the Services and free of any charge, the services, facilities and property described , at the times and in the manner specified in the SCC or terms of reference.
30.2 In case that such services, facilities and property shall not be made available to the Bidder, the Parties shall agree on (i) any time extension that it may be appropriate to grant to the Bidder for the performance of the Services, (ii) the manner in which the Bidder shall procure any such services, facilities and property from other sources, and (iii) the additional payments, if any, to be made to the Bidder as a result thereof.
F. Payments to the Bidder
31. Contract Price
31.1 The price payable shall be in Pakistani Rupees unless otherwise specified in the SCC. Prices charged by the Supplier for Goods delivered under the Contract shall not vary from the prices quoted by the Supplier in its Bid.
32. Terms and Conditions of Payment
32.1 Payments will be made to the Bidder according to the payment schedule stated in the SCC and as per actual invoice submitted by the Bidder.
32.2 Unless otherwise stated in the SCC, the advance payment shall be made against the provision by the Bidder of a bank guarantee for the same amount, and shall be valid for the period stated in the SCC. Any other payment shall be made after the conditions listed in the SCC for such payment have been met, and the Bidder have submitted an invoice to the Procuring Agency specifying the amount due.
33. Currency of Payment
33.1 Any payment under this Contract shall be made in the currency(ies) specified in the SCC.
G. Quality Control
34. Identifying Defects
34.1 The principle and modalities of Inspection of the Goods by the Procuring Agency shall be as indicated in the SCC. The Procuring Agency shall check the Bidder’s performance and notify him of any Defects that are found. Such checking shall not affect the Bidder’s responsibilities. The Procuring Agency may instruct the Bidder to search for a Defect and to uncover and test any service that the Procuring Agency considers may have a Defect. Defect Liability Period is as defined in the SCC.
35. Correction of Defects,and
Lack of Performance Penalty
35.1 The Procuring Agency shall give notice to the Bidder of any Defects before the end of the Contract. The Defects liability period shall be extended for as long as Defects remain to be corrected.
35.2 Every time notice a Defect is given, the Bidder shall correct the notified Defect within the length of time specified by the Procuring Agency’s notice.
35.3 If the Bidder has not corrected a Defect within the time specified in the Procuring Agency’s notice, the Procuring Agency will assess the cost of having the Defect corrected, the Bidder will pay this amount, and a Penalty for Lack of Performance.
36. Taxes and Duties
36.1 A Supplier shall be entirely responsible for all taxes, duties, fees, etc., incurred until delivery of the contracted Goods to the Procuring Agency.
H. Settlement of Disputes
37. Alternate Dispute Resolution
37.1 The disputes between the parties to the contract may be settled in accordance with Public Procurement Rules, 2004.
37.2 The procuring agency shall refer the matter to the Chief Justice Islamabad High Court or Managing Director PPRA or the Secretary Ministry of Law & Justice for appointment of Arbitrator.
37.3 The fee for the Arbitrator shall be specified in Pak Rupees as determined by the appointing authority which shall be borne and shared equally by the contracting parties.
📑 Special Conditions of Contract (SCC)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
SECTION VIII. SPECIAL CONDITIONS OF CONTRACT
The following Special Conditions of Contract shall supplement the General Conditions of Contract. Whenever there is a conflict, the provisions herein shall prevail over those in the Conditions of Contract. The corresponding clause number of the GCC is indicated in parentheses.
Number of GC Clause
Amendments of, and Supplements to, Clauses in the General Conditions of Contract
Number of GC Clause 1
Definitions
The Procuring Agency is: National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory
The Supplier is:
The title of the subject procurement is: TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Number of GC Clause 3
Applicable/Governing Law:
The Contract shall be interpreted in accordance with the laws of Islamic Republic of Pakistan
Number of GC Clause 4
Language:
The language of the Contract, all correspondence and communications to be given, and all other documentation to be prepared and supplied under the Contract shall be in English.
Number of GC Clause 5
Notices:
The addresses for the notices are:
Procuring Agency:
National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director
Park Road, Islamabad Capital Territory
+92-333-855-4884
purchaseprocurement58@gmail.com
Contractor/ Bidder:
[Name, address and telephone number].
The Contractor/ Bidder’s Representative(s)
[Name, address, telephone number and e-mail address]
Number of GC Clause 7.1
The Authorized Representatives are:
For the Procuring Agency:
National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director
Park Road, Islamabad Capital Territory
+92-333-855-4884
purchaseprocurement58@gmail.com
For the Bidder:
Name: ………………………
Designation: ……………..
Address: ……………………………..
Number of GC Clause 8
Effectiveness of the contract
Number of GC Clause 9
Commencement of Contract:
Number of GC Clause 11.2
Expiration of Contract:
Number of GC Clause 15
Termination
In the event of termination of the contract due to any reason as already defined in the General Conditions of Contract, the Bidder shall be responsible for providing to the Authority the Goods till the time of alternate arrangements.
Number of GC Clause 17
Conflict of Interest:
The Procuring Agency reserves the right to determine on a case-by-case basis whether the Bidder should be disqualified from providing goods or services due to a conflict of a nature described in Clause GCC 17.
Number of GC Clause 22
Liquidated Damages
If the Bidder fails to provide services as required under the contract or in case of any data loss/data breach or any incident compromising the data security or other such failures related to any services, the Bidder shall pay to the Procuring Agency as Liquidated Damages at a rate of 1.00% to 1.00% of the Contract value, in accordance with the extent of performance failure & the cost of investigating such incidents as judged by the Authority.
Number of GC Clause 23
Performance Guarantee:
The amount of performance guarantee shall be 5.00% of the contract price in acceptable form of Pay Order, Call at Deposit, Demand Draft
Number of GC Clause 32
Payment terms:
Payment will be made to the Bidder against the procured Goods and services according to the actual invoice or running bills submitted by the Bidder against the services provided within the time given in the conditions of the contract.
Number of GC Clause 33
Currency of Payment:
All the payment to be released to the contractor/Bidder shall be in Pakistani Rupees.
Number of GC Clause 34
Identifying Defects:
The Authority reserves the right at any time to inspect the premises of the provider to inspect the goods and monitor the goods being provided.
Number of GC Clause 37
Following is the guidance for Dispute Resolution
- If any dispute of any kind whatsoever shall arise between the Authority and the Bidder in connection with or arising out of the Contract, including without prejudice to the generality of foregoing, any question regarding its existence, validity, termination and the execution of the Contract – whether during developing phase or after their completion and whether before or after the termination, abandonment or breach of the Contract – the parties shall seek to resolve any such dispute or difference by mutual diligent negotiations in good faith within 14 (fourteen) days following a notice sent by one Party to the other Party in this regard.
- At future of negotiation the dispute shall be resolved through mediation and mediator shall be appointed with the mutual consent of the both parties.
- At the event of failure of mediation to resolve the dispute relating to this contract such dispute shall finally be resolved through binding Arbitration by sole arbitrator in accordance with Arbitration Act 1940. The arbitrator shall be appointed by mutual consent of the both parties. The Arbitration shall take place in Islamabad, Pakistan and proceedings will be conducted in English language.
- The cost of the mediation and arbitration shall be shared by the parties in equal proportion however the both parties shall bear their own costs and lawyer’s fees regarding their own participation in the mediation and arbitration. However, the Arbitrator may make an award of costs upon the conclusion of the arbitration making any party to the dispute liable to pay the costs of another party to the dispute.
- Arbitration proceedings as mentioned in the above clause regarding resolution of disputes may be commenced prior to, during or after completion of the contract.
Notwithstanding any reference to the arbitration herein, the parties shall continue to perform their respective obligations under the Contract unless they otherwise agree that the Authority shall pay the Bidder any monies due to the Bidder.
Rules of procedure for arbitration proceedings:
Any dispute between the Authority and a Bidder who is a national of the Islamic Republic of Pakistan arising in connection with the present Contract shall be referred to adjudication or arbitration in accordance with the laws of the Islamic Republic of Pakistan including Arbitration Act 1940, however above provision shall prevail in referring the case to the Arbitrator.
Place of Arbitration and Award:
The arbitration shall be conducted in English language and place of arbitration shall be at Islamabad. The award of the arbitrator shall be final and shall be binding on the parties.
📑 Bid Securing Declaration (BSD)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
Form 9: Bid Securing Declaration
Date: [insert date (as day, month and year)]
Bid No.:P100384
To: National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory
We, the undersigned, declare that:
We understand that, according to your conditions, Bids must be supported by a Bid Securing Declaration.
We accept that we will be blacklisted and henceforth cross debarred for participating in respective category of public procurement proceedings for a period of (not more than) six months, if fail to abide with a bid securing declaration, however without indulging in corrupt and fraudulent practices, if we are in breach of our obligation(s) under the Bid conditions, because we:
- have withdrawn or modified our Bid during the period of Bid Validity specified in the Form of Bid;
- Disagreement to arithmetical correction made to the Bid price; or
- having been notified of the acceptance of our Bid by the Procuring Agency during the period of Bid Validity, (i) failure to sign the contract if required by Procuring Agency to do so or (ii) fail or refuse to furnish the Performance Security or to comply with any other condition precedent to signing the contract specified in the Bidding Documents.
We understand this Bid Securing Declaration shall expire if we are not the successful
Bidder, upon the earlier of (i) our receipt of your notification to us of the name of the successful Bidder; or (ii) twenty-eight (28) days after the expiration of our Bid.
📑 Contract Form (CNF)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
SECTION IX: CONTRACT FORMS
THIS AGREEMENT made the _____ day of __________ 20_____ between National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory
(hereinafter called “the Procuring Agency”) of the one part and [name of Bidder] of [city and country of Bidder] (hereinafter called “the Bidder”) of the other part:
WHEREAS the Procuring Agency invited Bids for provision of goods, viz., TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH (P100384) and has accepted a Bids by the Bidder for the provision of Goods in the sum of [contract price in words and figures] (hereinafter called “the Contract Price”).
NOW THIS CONTRACT WITNESSETH AS FOLLOWS:
1. In this Contract words and expressions shall have the same meanings as are respectively assigned to them in the Conditions of Contract referred to.
2. The following documents shall be deemed to form and be read and construed as part of this Contract, In the event of any ambiguity or conflict between the Contract Documents listed below, the order of precedence shall be the order in which the Contract Documents are listed below:-
- This form of Contract;
- the Form of Bids and the Price Schedule submitted by the Bidder;
- the Schedule of Requirements;
- the Technical Specifications;
- the Special Conditions of Contract;
- the General Conditions of the Contract;
- the Procuring Agency’s Letter of Acceptance; and
- [add here: any other documents]
3. In consideration of the payments to be made by the Procuring Agency to the Bidder as hereinafter mentioned, the Bidder hereby covenants with the Procuring Agency to provide the Goods related services and to remedy defects therein in conformity in all respects with the provisions of the Contract.
4. The Procuring Agency hereby covenants to pay the Bidder in consideration of the provision of Goods and the remedying of defects therein, the Contract Price or such other sum as may become payable under the provisions of the contract at the times and in the manner prescribed by the contract.
IN WITNESS whereof the parties hereto have caused this Contract to be executed in accordance with their respective laws the day and year first above written.
Signed, sealed, delivered by __________________the ________________ (for the Procuring Agency)
Witness to the signatures of the Procuring Agency:
………………………………………………
Signed, sealed, delivered by __________________the ________________ (for the Procuring Agency)
Witness to the signatures of the Bidder: …………………………………………………
📑 Integrity Pact (INP)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
Integrity Pact
DECLARATION OF FEES, COMMISSION AND BROKERAGE ETC. PAYABLE BYTHE SUPPLIERS OF GOODS, SERVICES & WORKS IN CONTRACTS WORTH RS.10.00 MILLION OR MORE
Contract Number: Contract Value: Contract Title:
Dated:
[Name of Supplier] hereby declares that it has not obtained or induced the procurement of any contract, right, interest, privilege or other obligation or benefit from Government of Pakistan or any administrative subdivision or agency thereof or any other entity owned or controlled by it (GoP) through any corrupt business practice.
Without limiting the generality of the foregoing [Name of Supplier] represents and warrants that it has fully declared the brokerage, commission, fee etc. paid or payable to anyone and not given or agreed to give and shall not give or agree to give to anyone within or outside Pakistan either directly or indirectly through any natural or juridical person, including its affiliate, agent, associate, broker, consultant, director, promoter, shareholder, sponsor or subsidiary, any commission, gratification, bribe, finder's fee or kickback, whether described as consultations fee or otherwise, with the object of obtaining or inducing the procurement of a contract, right, interest, privilege or other obligation or benefit in whatsoever form from GoP, except that which has been expressly declared pursuant hereto.
[Name of Supplier] certifies that it has made and will make full disclosure of all agreements and arrangements with all persons in respect of or related to the transaction with GoP and has not taken any action or will not take any action to circumvent the above declaration, representative or warranty.
[Name of Supplier] accepts full responsibility and strict liability for making and false declaration, not making full disclosure, misrepresenting fact or taking any action likely to defeat the purpose of this declaration, representation and warranty. It agrees that any contract, right interest, privilege or other obligation or benefit obtained or procured as aforesaid shall, without prejudice to any other right and remedies available to GoP under any law, contract or other instrument, be voidable at the option of GoP.
Notwithstanding any rights and remedies exercised by GoP in this regard, [Name of Supplier] agrees to indemnify GoP for any loss or damage incurred by it on account of its corrupt business practices and further pay compensation to GoP in an amount equivalent to ten time the sum of any commission, gratification, bribe, finder's fee or kickback given by [Name of Supplier] as aforesaid for the purpose of obtaining or inducing the procurement of any contract, right, interest, privilege or other obligation or benefit in whatsoever form from GoP.
📑 Performance Guarantee Form (PGF)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
Performance Guarantee Form
To: National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory
WHEREAS [name of Bidder] (hereinafter called “the Bidder”) has undertaken, in pursuance of Contract No. [reference number of the contract] dated [insert date] for provision of Goods(hereinafter called “the Contract”).
AND WHEREAS it has been stipulated by you in the said Contract that the Bidder shall furnish you with a Bank Guarantee by a reputable bank for the sum specified therein as security for compliance with the Bidder’s performance obligations in accordance with the Contract.
AND WHEREAS we have agreed to give the Bidders guarantee:
THEREFORE, WE hereby affirm that we are Guarantors and responsible to you, on behalf of the Bidder, up to a total of [amount of the guarantee in words and figures], and we undertake to pay you, upon your first written demand declaring the Bidder to be in default under the Contract and without cavil or argument, any sum or sums within the limits of [amount of guarantee] as aforesaid, without your needing to prove or to show grounds or reasons for your demand or the sum specified therein.
This guarantee is valid until the: [insert date]
Signature and seal of the Guarantors
_____________________________________________________________________
[name of bank or financial institution]
_____________________________________________________________________
[address]
_____________________________________________________________________
[date}
📑 Annexure (ANX)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384
Tender Items list and Terms & conditions
Information (Read-Only)📑 Procurement Forms (PFD)
TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH
Published on: Friday, September 18, 2026 08:02 PM
Ref# : P100384