Standard Bidding Document

📑 Procurement Notice (NIT)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

REQUEST FOR BIDS

PROCUREMENT OF GOODS

  1. The National Institutes of Health (NIH) (National Institutes of Health (NIH)) has reserved Funds for the procurement planned for FY 2026-27. The National Institutes of Health (NIH) (National Institutes of Health (NIH)) intends to apply part of the proceeds of this Fund to cover eligible payments under the contract for the "TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIHwith the reference of "P100384"
  2. The National Institutes of Health (NIH) (National Institutes of Health (NIH)) invites sealed Bids from eligible Bidders for procurement of goods described in the bidding documents on EPADS v2.0.
  3. Single Stage-One Envelope will be used by adopting Least Cost Based Selection (LCBS) Technique for the subject procurement, in line with the Public Procurement Rules, 2004 and any Regulations, Regulatory Guides, Procurement Guidelines or Instructions issued by the Authority from time to time.
  4. All Bids must be accompanied by a Bid Security amounting described in Bid Security Section in Bidding Document in the form of  Pay Order, Call at Deposit, Demand Draft or all bids must be accompanied by bid securing declaration in the format specified in the Bidding documents
  5. E-Bidding documents, containing detailed terms & conditions, specifications and requirements etc. are available on e-Pak Acquisition and Disposal System (EPADS) at https://epads.gov.pk/opportunities/federal/procurements/100384 for all the interested bidders registered on EPADS v2.0. Bidders are required to get themselves registered on EPADS v2.0 to participate in Bidding process.
  6. The e-bids, prepared in accordance with the instructions in the e-Bidding Documents, must be submitted through EPADS v2.0 on or before Wednesday, October 14, 2026 11:00 AM. E-bids will be opened using EPADS v2.0 on the same day at Wednesday, October 14, 2026 11:30 AM. Manual submission of Bids shall not be entertained. Those vendors who have not yet registered on the new version of EPADS v2.0, may register themselves on https://vendors.epads.gov.pk/. A tutorial to explain the registration process is available at https://www.youtube.com/watch?v=MNW6T38v7tc

In terms of Rule 48 of Public Procurement Rules, 2004 Grievance Redressal Committee (GRC) is notified for the subject procurement and notification copy is available on the procuring agency’s website and on Authority’s website at (www.ppra.org.pk).

 

 

National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director
Park Road, Islamabad Capital Territory
+92-333-855-4884
purchaseprocurement58@gmail.com

📑 Instructions to Bidders (ITB)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

A. Introduction

1.Scope of Bids

1.1 The Procuring Agency (PA), as indicated in the Bids Data Sheet (BDS) invites Bids through EPADS v2.0 for the provision of Goods for as specified in the BDS and in Section V – Evaluation Criteria, Specifications & Schedule of Requirements. The name, identification, and number of items/deliverables are provided in the BDS. The successful Bidders will be expected to provide the goods within the specified period and timeline(s) as stated in the BDS.

2. Source of Funds

2.1 Source of funds is referred in Clause-1 of Invitation for Bids.

3. Eligible Bidders

3.1  A Bidder may be natural person, company or firm or public or semi-public agency of Pakistan or any foreign country, or any combination of them with a formal existing agreement (on Judicial Papers) in the form of a joint venture, consortium, or association. In the case of a joint venture, consortium, or association, all members shall be jointly and severally liable for the execution of the Contract in accordance with the terms and conditions of the Contract. The joint venture, consortium, or association shall nominate a Lead Member as nominated in the BDS, who shall have the authority to conduct all business for and on behalf of any and all the members of the joint venture, consortium, or association during the Bidding process, and in case of award of contract, during the execution of the contract.

3.2  Verifiable copy of the agreement that forms a joint venture, consortium or association shall be required to be submitted as part of the Bid.

3.3  The appointment of Lead Member in the joint venture, consortium, or association shall be confirmed by submission of a valid Power of Attorney to the Procuring Agency.

3.4  Any bid submitted by the joint venture, consortium or association shall indicate the part of proposed contract to be performed by each party and each party shall be evaluated (or post qualified if required) with respect to its contribution only, and the responsibilities of each party shall not be substantially altered without prior written approval of the Procuring Agency and in line with any instructions issued by the Authority.

(The limit on the number of members of JV or Consortium or Association may be prescribed in BDS, in accordance with the guidelines issued by the PPRA).

3.5  The invitation for Bids is open to all prospective suppliers, manufacturers, or authorized agents / dealers subject to any provisions of incorporation or licensing by the respective national incorporating agency or statutory body established for that particular trade or business. Procuring agencies shall specify the registration/licensing requirements for the foreign bidders keeping in view the requirement of that business.

3.6  A Bidder shall not have a conflict of interest. All Bidders found to have a conflict of interest shall be disqualified. A Bidder may be considered to have a conflict of interest with one or more parties in this Bidding process, if they:

  1. are associated or have been associated in the past, directly or indirectly with a firm or any of its affiliates which have been engaged by the Procuring Agency to provide consulting services for the preparation of the design, specifications and other documents to be used for the procurement of the Goods to be purchased under this Invitation for Bids.
  2. have controlling shareholders in common; or
  3. receive or have received any direct or indirect subsidy from any of them; or
  4. have the same legal representative for purposes of this Bid; or
  5. have a relationship with each other, directly or through common third parties, that puts them in a position to have access to information about or influence on the Bids of another Bidder, or influence the decisions of the Procuring Agency regarding this Bidding process; or     
  6. Submit more than one Bid in this Bidding process.

3.7  A Bidder may be ineligible if –

  1. he is declared bankrupt or, in the case of company or firm, insolvent;
  2. payments in favor of the Bidder is suspended in accordance with the judgment of a court of law other than a judgment declaring bankruptcy and resulting (in accordance with the national laws) in the total or partial loss of the right to administer and dispose of its property;
  3. the Bidder is convicted, by a final judgment, of any offence involving professional conduct;
  4. the Bidder is blacklisted locally or by international organizations and hence debarred due to involvement in corrupt and fraudulent practices, or performance failure or due to breach of Bid securing declaration.  

3.8  As and when required, bidders shall provide to the Procuring Agency evidence of their eligibility, proof of compliance with the necessary legal requirements to carry out the contract effectively.

3.9  Bidders shall submit Bids relating to the nature, conditions and modalities of sub-contracting wherever the sub-contracting of any elements of the contract amounting to more than ten (10) percent of the Bid price is envisaged.

4. Eligible Goods and Related Services

4.1  All goods and related services to be supplied under the contract shall have their origin in eligible source countries, and all expenditures made under the contract will be limited to such goods and services. For purpose of this Bid, ineligible countries are the countries declared ineligible by the Federal Government. 

5. One Bid per Bidder

5.1  A bidder shall submit only one Bid, in the same bidding process, either individually as a Bidder or as a member in a joint venture or any similar arrangement.

5.2  The Bidder shall not engage a subcontractor for any portion of the contract if the value of such subcontracting exceeds thirty percent (30%) of the total contract amount.

6. Cost of Bidding

6.1   Any cost incurred by the bidder relating to the preparation and submission of its Bid shall be borne by the bidder, and the Procuring Agency shall in no case be responsible or liable for those costs, regardless of the conduct or outcome of the bidding process.

B. Bidding Documents

7. Contents of  Bidding Document

7.1  The Goods required, Bidding procedures, and terms and conditions of the contract are prescribed in the Bidding Documents.  In addition to the Invitation for Bids, the Bidding documents which should be read in conjunction with any addenda issued in accordance with ITB 9.1 include:

Section I -Invitation to Bids

Section II Instructions to Bidders (ITB)

Section III Bid Data Sheet (BDS)

Section IV Evaluation Criteria, Specifications, Schedule of Requirements

Section V Bid Forms

Section VI General Conditions of Contract (GCC)

Section VII Special Conditions of Contract (SCC)

Section VIII Contract Forms

7.2  The Bidder is expected to examine all instructions, forms, terms and specifications in the Bidding documents. Failure to furnish all the information required in the Bidding documents through EPADS v2.0 will be at the Bidder’s risk and may result in the rejection of his Bids.

8. Clarification of Bidding documents

8.1  A prospective Bidder requiring any clarification of the Bidding documents may notify the Procuring Agency through EPADS v2.0.

8.2  The Procuring Agency will within three (3) working days after receiving the request for clarification, respond to any request for clarification through EPADS v2.0 provided that such request is received not later than three (03) days prior to the deadline for the submission of Bids as prescribed in ITB 22

8.3  Copies of the Procuring Agency's response will be forwarded to all identified Prospective Bidders through EPADS v2.0, including a description of the inquiry, but without identifying its source.

8.4  Should the Procuring Agency deem it necessary to amend the Bidding document as a result of a clarification, it shall do so following the procedure under ITB 9.

8.5  If indicated in the BDS, the Bidder’s designated representative is invited at the Bidder’s cost to attend a pre-Bid meeting at the place, date and time mentioned in the BDS. During this pre-Bid meeting, prospective Bidders may request clarification of the schedule of requirement, the Evaluation Criteria or any other aspects of the Bidding document.

8.6  Minutes of the pre-Bid meeting, if applicable, including the text of the questions asked by Bidders, including those during the meeting (without identifying the source) and the responses given, together with any responses prepared after the meeting will be uploaded on EPADS v2.0. Any modification to the Bidding documents that may become necessary as a result of the pre-Bid meeting shall be made by the Procuring Agency exclusively through the use of an Addendum pursuant to ITB 9. Non-attendance at the pre-Bid meeting will not be a cause for disqualification of a Bidder.

9. Amendment of Bidding documents

9.1  Before the deadline for submission of Bids, the Procuring Agency for any reason, whether at its own initiative or in response to a clarification requested by a prospective Bidder or Pre-Bid meeting may modify the Bidding documents by issuing addenda through EPADS v2.0.

9.2  The Procuring Agency shall promptly publish the addendum through EPADS v2.0.

9.3  Any addendum issued including the notice of any extension of the deadline shall also be communicated through EPADS v2.0 to all the bidders who have already submitted their bids. Such bidders shall have the right to withdraw their already submitted bid and re-submit the revised bid prior to the original or extended bid submission deadline.

9.4  To give prospective Bidders reasonable time in which to take an addendum/corrigendum into account in preparing their Bids, the Procuring Agency may, at its discretion, extend the deadline for the submission of Bids through EPADS v2.0:

Provided that the Procuring Agency shall extend the deadline for submission of Bids, if such an addendum is issued within last three (03) days of the Bids submission deadline.

C. Preparation of Bids

10. Language of Bid

10.1  The Bid prepared by the bidder, as well as all correspondence and documents relating to the Bids exchanged by the Bidder and the Procuring Agency shall be written in the English language unless otherwise specified in the BDS.  Supporting documents and printed literature furnished by the Bidder may be in another language provided they are accompanied by an accurate translation of the relevant pages in the English language unless otherwise specified in the BDS, in which case, for purposes of interpretation of the Bidder, the translation shall govern.

11. Documents and samples Constituting the Bid

11.1  The Bid prepared by the Bidder shall constitute thedocuments required in the BDS.

Details of sample(s) where applicable and requested in the BDS.

1.  Documentary evidence established in accordance with ITB that the Bidder is eligible and/or qualified for the subject bidding process;

2.  Documentary evidence establish that the Bidder has been authorized by the manufacturer to deliver the goods into Pakistan, where required and where the supplier is not the manufacturer of those goods;

3.  Documentary evidence establish that the goods and related services to be supplied by the Bidder are eligible goods and services, and conform to the Bidding Documents;

4.  Bid security or Bid Securing Declaration furnished in accordance with ITB 18.

12. Documents Establishing Eligibility of the Goods and Conformity to Bidding documents

12.1  To establish the conformity of the bidder to the Bidding document, the Bidder shall furnish as part of its Bids the documentary evidence that Goods provided conform to the technical specifications and standards.

13. Documents Establishing Eligibility and Qualification of the Bidder

13.1  The Bidder shall furnish, as part of itsBid, all those documents establishing the Bidder’s eligibility to participate in the Bidding process and/or its qualification to perform the contract if its Bid is accepted.

14. Form of Bids

14.1  The Bidder shall fill the Form of Bid furnished in the Bidding documents.The Bids Form must be completed without any alterations to its format and no substitute shall be accepted.

15. Bids Prices

15.1  The Bids Prices quoted by the Bidder in the Form of Bid and in the Price Schedules shall conform to the requirements specified below or exclusively mentioned hereafter in the Bidding documents.

15.2  All items in the Schedule of Requirement must be listed and priced separately in the Price Schedule(s). If a Price Schedule shows items listed but not priced and neither explicitly denied, their prices shall be construed to be included in the prices of other items.

15.3  Items not listed in the Price Schedule shall be assumed not to be included in the Bid, and provided that the Bid is still substantially responsive in their absence or due to their nominal nature, the corresponding average price of the respective item(s) of the remaining substantially responsive Bidder(s) shall be construed to be the price of those missing item(s)

15.4  The Bid price to be quoted in the Form of Bid in accordance with ITB 14.1 shall be the total price of the Bid.

15.5  The Bidder shall indicate on the appropriate Price Schedule, the unit prices (where applicable) and total Bid price of the Goods it proposes to provide under the contract.

15.6  Prices quoted by the Bidder shall be fixed during the Bidder’s performance of the contract and not subject to variation on any account. A Bid submitted with an adjustable price will be treated as non-responsive and shall be rejected.

16. Bids Currencies

16.1 Prices shall be quoted in Pakistani Rupees unless otherwise specified in the BDS in accordance with Rule 30 (2) of the Public Procurement Rules, 2004.

17. Bids Validity Period

17.1  Bids shall remain valid for the period specified in the BDS after the Bid submission deadline prescribed by the Procuring Agency. A Bid valid for a shorter period shall be rejected by the Procuring Agency as non-responsive. The period of Bid validity will be determined from the complementary Bid securing instrument, i.e. the expiry period of Bid Security or Bids Securing Declaration as the case may be.

17.2  The procuring agency shall ordinarily be under an obligation to process and evaluate the bid and to issue letter of award within the stipulated bid validity period.

17.3  Under exceptional circumstances, prior to the expiration of the initial Bid validity period, the Procuring Agency may request the Bidders’ consent to an extension of the period of validity of their Bids only once through EPADS v2.0, for the period not more than the period of initial bid validity. The Bid Security provided under ITB 18 shall also be suitably extended. A Bidder may refuse the request without forfeiting its Bid security or causing to be executed its Bid Securing Declaration.  A Bidder agreeing to the request will not be required nor permitted to modify its Bid, but will be required to extend the validity of its Bid Security or Bid Securing Declaration for the period of the extension.

18. Bid Security or Bid Securing Declaration

18.1  The Bidder shall furnish as part of its Bid, a Bid Security in accordance with Rule 25 of the Public Procurement Rules, 2004.

18.2  The original Bid Security shall be enclosed within the sealed envelope and to be submitted physically before closing time for submission of bids. Whereas, scanned copy of bid security shall be uploaded electronically through EPADS v2.0 before closing hours for submission of bids.

18.3  The Bidder who failed to submit the original Bids security before the submission deadline shall be disqualified straightaway. 

18.4  The Bid Security or Bid Securing Declaration is required to protect the Procuring Agency against the risk of Bidder’s conduct which would warrant the security’s forfeiture, pursuant to ITB 18.7.

18.5  The Bid Security shall be denominated in the local currency, and it shall be a Bank Draft in the name of the Procuring Agency and valid for twenty-eight (28) days beyond the end of the validity of the Bid. This shall also apply if the period for Bids/Bid Validity is extended. In either case, the form must include the complete name of the Bidder.

18.6  The Bid Security shall be payable promptly upon written demand by the Procuring Agency in case any of the conditions listed in ITB 18 are invoked.

18.7  Unsuccessful Bidders’ Bid Security will be discharged or returned as promptly as possible, however in no case later than thirty (30) days after the expiration of the period of Bids Validity prescribed by the Procuring Agency pursuant to ITB 17. The Procuring Agency shall make no claim to the amount of the Bid Security, and shall promptly return the Bid Security document, after whichever of the following that occurs earliest:

  1. the expiry of the Bid Security;
  2. the entry into force of a procurement contract and the provision of a Performance Guarantee, for the performance of the contract if such a guarantee, is required by the Bid documents;
  3. the rejection by the Procuring Agency of all Bids;
  4. the withdrawal of the Bids prior to the deadline for the submission of Bids, unless the Bids documents stipulate that no such withdrawal is permitted.

18.8  The successful Bidder’s Bids Security will be discharged upon the Bidder signing the contract, or furnishing the Performance Guarantee.

18.9  The Bid Security may be forfeited or the Bid Securing Declaration executed:

  1.  if a Bidder:
  2. withdraws its Bid during the period of Bid Validity as specified by the Procuring Agency, and referred by the Bidder on the Form of Bids except as provided for in ITB 17.2; or
  3. does not accept the correction of errors; or
  4. in the case of a successful Bidder, if the Bidder fails:
  5. to sign the contract; or
  6. to furnish Performance Guarantee.

19. Withdrawal, Substitution, and Modification of Bid

19.1  Before Bid submission deadline, any Bidder may withdraw, substitute, or modify its Bid after it has been submitted through EPADS v2.0. Bids requested to be withdrawn, shall be returned unopened to the Bidders through EPADS v2.0.

20. Format and Signing of Bid

20.1  The Bidder shall prepare and submit Bids with due diligence after carefully reading all the terms and condition before bid submission deadline through EPADS v2.0.

D. Submission of Bids

21.  Submission of Bids through EPADS v2.0

21.1  The Technical and Financial Bids if required to submitted, shall be submitted on EPADS v2.0.  

22. Deadline for Submission of Bids

22.1  Bids shall be received by the Procuring Agency through EPADS v2.0 before bid submission deadline.

22.2  The Procuring Agency may, under exceptional circumstances, extend the deadline for the submission of Bids, after recording reasons in writing and in an equal opportunity manner.   

In such case, all rights and obligations of the Procuring Agency and the Bidders that were previously governed by the original deadline shall thereafter be subject to the revised deadline.

E. Opening and Evaluation of Bids

23. Opening of Bids

23.1  The Bid Evaluation Committee of the Procuring Agency shall open all Bids through the EPADS v2.0, on the date and time specified in the Bid Data Sheet (BDS).

23.2  The Bid Evaluation Committee shall generate minutes through EPADS v2.0 containing brief details of bid opening process. The record of the Bid opening shall include, as a minimum: the name of the Bidder, the Bid price if applicable, and the presence or absence of a Bid Security or Bid Securing Declaration.

23.3  The procuring agency shall live broadcast the opening of bids on national media or on their website or digital channels, if the volume of procurement exceeds five hundred million rupees in case of goods and services and one thousand million rupees in case of works.

23.4  In case the date of opening of bid has been declared as public holiday or the procuring agency fail to open bid due to any EPADS v2.0 related issues, the submission and opening of bids shall be shifted to the next working day on the same time.

23.5  In case of Single Stage One Envelope Procedure, the Bidders names, the Bid prices, the total amount of each Bid and, the presence or absence of Bid Security, Bid Securing Declaration and such other details as the Procuring Agency may consider appropriate, will be announced by the Bid Evaluation Committee.

24. Clarification of Bids

24.1  To assist in the examination, evaluation and comparison of Bids of the Bidders, the Procuring Agency may, ask any Bidder for a clarification of its Bid including breakdown of prices.   

24.2  The request for clarification and the response shall be sought through EPADS v2.0 before three days prior to the deadline for submission of bids. No change in the prices or substance of the Bids shall be sought, offered, or permitted.

24.3  The alteration or modification in the BIDS which in any way affect the following parameters will be considered as a change in the substance of a Bids:

  1. evaluation & qualification criteria;
  2. required scope of work or specifications;
  3. all securities requirements;
  4. tax requirements;
  5. terms and conditions of Bidding documents.
  6. change in the ranking of the Bidder

24.4  From the time of Bids opening to the time of Contract award if any Bidder wishes to contact the Procuring Agency on any matter related to the Bids it should do so through EPADS v2.0.

25. Preliminary Examination of Bids

25.1  Prior to the detailed evaluation of Bids, the Procuring Agency will determine whether each Bid:

  1. meets the eligibility criteria defined in ITB 3;
  2. has been prepared as per the format and contents defined by the Procuring Agency in the Bidding documents;
  3. is accompanied by the required securities; and
  4. is substantially responsive to the requirements of the Bidding documents.

25.2  The Procuring Agency's determination of a Bid's responsiveness will be based on the contents of the Bid itself.

25.3  A substantially responsive Bid is one which conforms to all the terms, conditions, and specifications of the Bidding documents, without material deviation or reservation. A material deviation or reservation is one that: -

  1. affects in any substantial way the scope, quality, or performance of the Goods;
  2. limits in any substantial way, inconsistent with the Bidding documents, the Procuring Agency's rights or the Bidders obligations under the Contract; or
  3. if rectified, would affect unfairly the competitive position of other Bidders presenting substantially responsive Bids.

25.3  If a Bids is not substantially responsive, it will be rejected by the Procuring Agency and may not subsequently be evaluated for complete technical responsiveness.

26. Examination of Terms and Conditions; Technical Evaluation

26.1  The Procuring Agency shall examine the Bids to confirm that all terms and conditions specified in the GCC and the SCC have been accepted by the Bidder without any material deviation or reservation.

26.2  The Procuring Agency shall evaluate the technical aspects of the Bids submitted, to confirm that all requirements specified in Schedule of Requirements and Technical Specifications of the Bidding documents have been met without material deviation or reservation.

26.3  If after the examination of the terms and conditions and the technical evaluation, the Procuring Agency determines that the Bid is not substantially responsive in accordance with ITB 25.2, it shall reject the Bid.

27. Correction of Errors

27.1  Bids determined to be substantially responsive will be checked for any arithmetic errors.  Errors will be corrected as follows: -

  1. if there is a discrepancy between unit prices and the total price that is obtained by multiplying the unit price and quantity, the unit price shall prevail, and the total price shall be corrected, unless in the opinion of the Procuring Agency there is an obvious misplacement of the decimal point in the unit price, in which the total price as quoted shall govern and the unit price shall be corrected;
  2. if there is an error in a total corresponding to the addition or subtraction of sub-totals, the sub-totals shall prevail and the total shall be corrected; and
  3. where there is a discrepancy between the amounts in figures and in words, the amount in words will govern.
  4. Where there is discrepancy between grand total of price schedule and amount mentioned on the Form of Bids, the amount referred in Price Schedule shall be treated as correct subject to elimination of other errors.

27.2  The amount stated in the Bid will, be adjusted by the Procuring Agency in accordance with the above procedure for the correction of errors and, with the concurrence of the Bidder, shall be considered as binding upon the Bidder. If the Bidder does not accept the corrected amount, its Bid will then be rejected, and the Bid Security may be forfeited or the Bids Securing Declaration may be executed.

28. Conversion to Single Currency

28.1  To facilitate evaluation and comparison, the Procuring Agency will convert all Bids prices expressed in the amounts in various currencies in which the Bids prices are payable. For the purposes of comparison of bids quoted in different currencies, the price shall be converted into a single currency specified in the bidding documents. The rate of exchange shall be the selling rate prevailing on the date of opening of financial bids specified in the bidding documents, in accordance with weighted average customer exchange rates list issued by the State Bank of Pakistan on that day.

29. Evaluation of Bids

29.1  The Bids, quotations, or proposals shall be evaluated by the respective evaluation committees as per evaluation criteria described in the Bidding Documents in accordance with Rule 29 and 30 of the Public Procurement Rules, 2004.

1. Least Cost Based Selection (LCBS)
After meeting the requirements of eligibility, qualification and substantial responsiveness, the bid in compliance with all the mandatory (technical) specifications/requirements and/or requisite quality threshold (if any), and having lowest evaluated cost (or financial proposal) shall be considered Successful Bid.

2. Quality and Cost Based Selection (QCBS)
In such combination, there shall be some specific weightage of both the technical features and financial aspects of the proposal. The financial marks shall be awarded on the basis of inverse proportion calculations. The successful bid shall be declared, on the basis of combined evaluation.

3. Quality Based Selection (QBS)
Atter meeting the requirements of eligibility, qualification and substantial responsiveness the bid in compliance with all the mandatory (technical) specifications/requirements and attaining highest marks in the Technical Evaluation considering all other qualitative and/or quantitative parameters (or point rated criteria) for technical proposal(s) such as working methodology, implementation plan, resource allocation, additional functionalities, risk management approach, knowledge transfer techniques, post implementation methodology etc. shall be treated as highest ranked bid. Later on, the financial proposal of highest ranked bidder shall be opened, however, in case of failure to proceed further with such a bidder, the procuring agency may resort to second highest bidder and so on.

29.2  In case of tie of bids, the bidders shall be provided an opportunity to offer their best and final monetary offer through EPADS v2.0. However, in no case the rates shall be higher than the original financial bids.

30. Domestic Preference

30.1  The procuring agency shall evaluate and compare bids, allow for preference to domestic bidders, while competing with the international bidders in accordance with the policies of Federal Government.

The percentage of preference, to be accorded shall be clearly mentioned in the bidding documents under the bid evaluation criteria.

31. Determination of Successful Bid

31.1  Selection technique will be adopted for determining the Successful Bid in accordance with the criteria referred in the BDS or prescribed in the separate section titled as Evaluation Criteria.

31.2  In case where the Procuring Agency adopts the Cost Based Evaluation Technique and, the Bid with the lowest evaluated price from amongst those which are eligible, compliant and substantially responsive shall be the Successful Bid.

31.3  The Procuring Agency may adopt the Quality & Cost Based Selection Technique due to the following two reasons:

1. Where the Procuring Agency knows about the main features, usage and output of the products; however not clear about the complete features, technical specifications and functionalities of the goods to be procured and requires the bidders to submit their proposals defining those features, specifications and functionalities; or

2. Where the Procuring Agency, in addition to the mandatory requirements and mandatory technical specifications, requires parameters specified in Evaluation Criteria to be evaluated while determining the quality of the goods.

31.4  In such cases, the Procuring Agency may allocate certain weightage to these factors as a part of Evaluation Criteria, and may determine the ranking of the bidders on the basis of combined evaluation in accordance with provisions of Rule 2(1)(h) of the Public Procurement Rules, 2004.

32. Abnormally Low Financial Bids

32.1Where the Bid price is considered to be abnormally low, the Procuring Agency shall perform price analysis either during determination of Successful Bids or as a part of the post-qualification process.

32.2  The Procuring Agency may reject an Abnormally low financial bids.

32.3  In order to identify the Abnormally Low Bids (ALB) following approaches can be considered to minimize the scope of subjectivity:

  1. Comparing the Bids price with the cost estimate;
  2. Comparing the Bids price with the Bids offered by other Bidders submitting substantially responsive Bids; and
  3. Comparing the Bids price with prices paid in similar contracts in the recent past either government- or development partner-funded.

32.4  The Procuring Agency will determine to its satisfaction whether the Bidder that is selected as having submitted the successful bid is qualified to perform the contract satisfactorily.

32.5  The determination will take into account the Bidder’s financial, technical, and production capabilities.  It will be based upon an examination of the documentary evidence of the Bidder’s qualifications submitted by the Bidder, as well as such other information as the Procuring Agency deems necessary and appropriate. Factors not included in these Bidding documents shall not be used in the evaluation of the Bidders’ qualifications.

32.6  Procuring Agency may seek “Certificate for Independent Price Determination” from the Bidder and the results of reference checks may be used in determining an award of contract.

Explanation: The Certificate shall be furnished by the Bidder. The Bidder shall certify that the price is determined keeping in view of all the essential aspects such as raw material, its processing, value addition, optimization of resources due to economy of scale, transportation, insurance and margin of profit etc.

32.7  An affirmative determination will be a prerequisite for award of the contract to the Bidder. A negative determination will result in rejection of the Bidder’s Bids, in which event the Procuring Agency will proceed to the next ranked Bidder to make a similar determination of that Bidder’s capabilities to perform satisfactorily.

F. Award of Contract

33. Criteria of Award

33.1 The Procuring Agency will award the Contract to the Bidder whose Bids has been determined to be substantially responsive to the Bidding documents and who has been declared as Most Advantageous Bidder.

34. Negotiations

34.1  The procuring agency shall not engage in negotiations with respect to scope and price with the bidder except when the procuring agency conducts a procurement using direct or negotiated contracting or a request for proposals with evaluation based on quality alone.

34.2  The procuring agency may negotiate with the most advantageous bid with a view to streamline the work or task execution, at the time of contract finalization on methodology, work plan, staffing, finalizing payment arrangements, delivery arrangements, minor amendments to the special conditions of the contract.

35. Procuring Agency Right to reject all bids

35.1  The Procuring Agency reserves the right to reject all bids or proposals at any time prior to the issuance of the Letter of Award, without incurring any liability, in accordance with Rule 33 of the Public Procurement Rules, 2004.

36. Procuring Agency’s Right to Vary Quantities at the Time of Award

36.1  The Procuring Agency reserves the right at the time of contract award to increase or decrease the quantity of Goods originally specified in these Bidding documents provided this does not exceed by 15%, without any change in unit price or other terms and conditions of the Bids and Bidding documents.

37. Notification of Award

37.1  Prior to the award of contract, the procuring agency shall announce and publish the result of bid evaluation on EPADS v2.0 in accordance with Rule 35 of the Public Procurement Rules, 2004.

37.2  The Bidder whose Bids has been accepted will be notified of the award by the Procuring Agency prior to expiration of the Bids/Bid Validity period. The Letter of Award will state the sum that the Procuring Agency will pay the successful Bidder in consideration for the delivery of Goods as prescribed by the Contract (hereinafter and in the Contract called the "Contract Price).

37.3  The Letter of award will constitute the formation of the Contract, subject to the Bidder furnishing the Performance Guarantee and signing of the contract.

38. Signing of Contract

38.1  Promptly after issuance of Letter of award, Procuring Agency shall send the successful Bidder the draft Contract, incorporating all terms and conditions as agreed by the parties to the contract.

38.2  Immediately after the Redressal of grievance by the GRC (if any), mandatory standstill period in accordance with Rule 35 of the Public Procurement Rules, 2004 and after fulfillment of all condition’s precedent of the Contract Form, the successful Bidder and the Procuring Agency shall sign the Contract. 

39. Corrupt & Fraudulent Practices

39.1  Procuring Agencies (including beneficiaries of Government funded projects and procurement) as well as Bidders/Contractors under Government financed contracts, observe the highest standard of ethics during the procurement and execution of such contracts, and will avoid to engage in any corrupt and fraudulent practices. 

F. Grievance Redressal & Complaint Review Mechanism

40. Constitution of Grievance Redressal

40.1  The Grievance Redressal Committee shall address the grievance, if any submitted by any party, including the bidder, in accordance with Rule 48 of the Public Procurement Rules, 2004 to be read with Redressal of Grievances Regulations, 2021.

40.2  In case if any party or the bidder is not satisfied with the decision of the GRC or if it fails to decide within ten days, the bidder or the party may file an appeal before the Appellate Committee of the Authority in accordance with Rule 48 of the Public Procurement Rules, 2004 to be read with Redressal of Grievances Regulations, 2021.

G. Mechanism of Blacklisting

41. Mechanism of Blacklisting

41.1  The Procuring Agency shall initiate blacklisting proceedings against any bidder, supplier, or contractor in accordance with the Mechanism for Blacklisting Regulations, 2024, read with Rule 19 of the Public Procurement Rules, 2004.

41.2  The blacklisted/debarred bidder may file the review petition before the Authority in accordance with Rule 19 of the Public Procurement Rules, 2004 to be read with Procedure of filing and disposal of Review Petitions Regulations, 2021.

📑 Bid Data Sheet (BDS)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

Bids Data Sheet (BDS)

The following specific data for the procurement of Goods to be procured shall complement, supplement, or amend the provisions in the Instructions to Bidders (ITB).  Whenever there is a conflict, the provisions herein shall prevail over those in ITB.

BDS Clause Number
ITB Number
Amendments of, and Supplements to, Clauses in the Instruction to Bidders

A. Introduction

BDS Clause Number 1
ITB Number 1.1

Name of Procuring Agency: National Institutes of Health (NIH) (National Institutes of Health (NIH))

The subject of procurement is: TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Expected commencement date: Monday, November 30, 2026

BDS Clause Number 2
ITB Number 2.1

Financial year for the operations of the Procuring Agency: 2026-27

Name and identification number of the Contract: P100384 

BDS Clause Number 3
ITB Clause Number 3.1

JV/Consortium or Association Allowed: No
Number of JV/Consortium Members: Nil
see section of eligibility criteria.

B. Bidding Documents

BDS Clause Number 4
ITB Number 8.1

The Bidders may seek clarifications through EPADS v2.0 : Clarification Date: Friday, September 25, 2026

C. Preparation of Bids

BDS Clause Number 5
ITB Number 10.1

The Language of all correspondences and documents related to the Bids shall be in: English 

List of documents required along with the bid: No

BDS Clause Number 6
ITB Number 11.1
Items/Lots and threre related documents:
See section items and Lots

BDS Clause Number 7
ITB Number 12.1

Items / Lots Specifications:

see section of items specifications.

BDS Clause Number 8
ITB Number 15.6

The price shall be Fixed.

BDS Clause Number 9
ITB Number 16.1

Currency of the Bids shall be : PKR

BDS Clause Number 10
ITB Number 17.1

The Bids/Bid Validity period shall be: 300 Days

BDS Clause Number 11
ITB Number 18.1

The amount of Bid Security shall be as defined in Bid Security Section for items and lots given in BDS 6
The Bid Security shall be in the form of: Pay Order, Call at Deposit, Demand Draft  

D. Submission of Bids

BDS Clause Number 12
ITB Number 20.1

Bid shall be submitted online on EPADS v2.0 whereas hard copy of the bid security should be submitted to the following;

Park Road, Islamabad Capital Territory before bid submission deadline.

Bids that are not submitted on EPADS v2.0 shall be disqualified.

The deadline for Bids submission is: Wednesday, October 14, 2026 11:00 AM

E. Opening and Evaluation of Bids

BDS Clause Number 13
ITB Number 23.1

The Bids opening shall take place on EPADS v2.0.

Day : Wednesday

Date: Wednesday, October 14, 2026

Time : 11:30 AM

BDS Clause Number 14
ITB Number 31.1

Selection technique adopted will be: Least Cost Based Selection (LCBS)
see Evaluation Criteria

F. Review of Procurement Decisions

BDS Clause Number 15
ITB Number 41.1

Grievence against this procurement shall be submitted online on EPADS v2.0.

Arbitrator shall be appointed by mutual consent of the both parties.

Eligibility Criteria

Bidder's Type Required Registration

Any

NADRA CITIZENSHIP (CNIC/NICOP)

FBR (NTN)

FBR (GSTN)

Eligibility Criteria Document
Bank Statement Yes

Evaluation Criteria

Eligibile bidder(s) with substantially responsive bid(s) offering Least Cost Based Selection (LCBS) shall be consider for the award of contract(s).

Least Cost Based Selection (LCBS)

Items/Lots

Items Without Lots :

Item UNSPSC Delivery Schedule Quantity Bid Security
Spirit Rectified, (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.) Spirits or liquors
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 40/Ltr
40/Ltr 95.02 PKR
Chloroform (AR grade), (Merck / BDH/ Equivalent) (Nut. Div.) Chloroform
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Ltr
10/Ltr 23.74 PKR
(AR grade) (Merck /BDH/ equivalent) NH4 OH (Nut. Div.)2.5 ltr Chemical management service
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Ltr
5/Ltr 29.68 PKR
(Merck / BDH/ equipment) (Nut. Div.) Equipment inspection service
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 25/Ltr
25/Ltr 148.46 PKR
(Merck / BDH/ Equivalent (Nut. Div.) Equipment inspection service
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Ltr
5/Ltr 12 PKR
Absolute Ethanol (AR grade) (Nut. Div.) Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 25/Ltr
25/Ltr 1485 PKR
Acetic Acid Glacial (AR grade) (Nut. Div.) Acetic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Ltr
2/Ltr 12 PKR
Acetic Acid Glacial (AR grade) Scharlau/ equivalent (Nut. Div.) Acetic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Ltr
10/Ltr 24 PKR
Acetone GC grade (Merck /BDH) (Nut. Div.) Acetone/alcohol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Ltr
2/Ltr 12 PKR
Acetonitrile (Nut. Div.) Acetonitrile
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
Acidum formicium (Nut. Div.) 2,3-diphosphoglyceric acid test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/ml
500/ml 1188 PKR
Agra Strip Pro (Total Aflatoxin) Romer Lab (Nut. Div.) Binding combs or strips
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Alkalinity HANNA Instrument (Nut. Div.) Alkaline phosphatase or isoenzymes test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Aluminum HANNA Instrument (Nut. Div.) Acetaminophen/aluminum acetate/chlorpheniramine/phenylpropanolam
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Aluminum oxid (Nut. Div.) Aluminum oxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 1188 PKR
Ammonia HR HANNA Instrument (Nut. Div.) Ammonia
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Ammonium Chloride (Merck / BDH) (Nut. Div.) Aminophylline/ammonium chloride/diphenhydramine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Ammonium Hydroxide (conc) (Nut. Div.) Ammonium hydroxide titrants
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Ammonium molybdate (Merck /BDH) (Nut. Div.) Aminophylline/ammonium chloride/diphenhydramine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Amyl alcohol (Nut. Div.)2.5ltr Acetone/alcohol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Qty
10/Qty 59 PKR
Anhydrous Sodium Fluoride (Nut. Div.) Calcium carbonate/sodium fluoride
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Kg
5/Kg 12 PKR
Antifoam tablets (Nut. Div.) Anti foaming agents
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1200/Qty
1200/Qty 2851 PKR
Arsenic Test Supelco Kit (Nut. Div.) Arsenic test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Ascorbic Acid (AR grade) (Nut. Div.) Ascorbic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Barium Chloride (Merk /BDH) (Nut. Div.) Barium Ba
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Barium Chloride AR Grade (Merck/ BDH) / equivalent (Nut. Div.) Barium Ba
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Kg
10/Kg 24 PKR
Benzoic acid (Nut. Div.) 4-aminobenzoic acid or Aminobenzoic acid or PABA or para-aminobenzoic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 12 PKR
Boric Acid (AR grade) (Nut. Div.) Acetone/basic fuchsin/boric acid/resorcinol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Kg
3/Kg 7 PKR
Bromine HANNA Instrument (Nut. Div.) Bromine Br
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Bromocresol green (Nut. Div.) Bromocriptine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Bromocresol green (Merck /BDH) (Nut. Div.) Bromocriptine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/g
100/g 238 PKR
Bromocresol purple (Merck /BDH) (Nut. Div.) Bromocriptine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Bromophenol blue (Nut. Div.) Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Bromothymol Blue (BTB) (Nut. Div.) Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Calcium carbonate (Nut. Div.) Acetaminophen/aspirin/calcium carbonate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Calcium Carbonate (Merck/ equivalent) (Nut. Div.) Acetaminophen/aspirin/calcium carbonate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 12/Kg
12/Kg 29 PKR
Calcium Colorimetric assay kits (Nut. Div.) Calcium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Calcium HANNA Instrument (Nut. Div.) Calcium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Calcium Marine HANNA Instrument (Nut. Div.) Calcium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Calcium oxide (Nut. Div.) Calcium oxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2851 PKR
Catalyst tablets for kjeldahl method (Nut. Div.) Acid catalysts
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1200/Qty
1200/Qty 12 PKR
CDTA (Cyclohexylenediaminetetraacetic acid) (Nut. Div.) Nandrolone cyclohexylpropionate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Kg
5/Kg 1188 PKR
Charcoal (Nut. Div.) Charcoal
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 12 PKR
Chlorine Test Kit 6991 LP-DPD Tablets Octet Comparator 0.01 to 1 Ppm and 1.0 to 6.0 Ppm (LA Motte/ Equivalent) (Nut. Div.) Chlorine Cl
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/gal
5/gal 89 PKR
Chloroform (AR grade) (Nut. Div.) Chloroform
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 15/Qty
15/Qty 2 PKR
Choarcoal activated AR grade (Nut. Div.) Charcoal
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 7 PKR
Chromium Vi LR HANNA Instrument (Nut. Div.) Chromium Cr
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 14 PKR
Citric acid (Nut. Div.) Alcohol/citric acid/salicylic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 6/Qty
6/Qty 6 PKR
Citric Acid (Commercial grade) (Nut. Div.) Alcohol/citric acid/salicylic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Copper acetate (Nut. Div.) Copper
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 594 PKR
Copper acetate(Merck /BDH) (Nut. Div.) Copper
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 250/g
250/g 7 PKR
Copper HR HANNA Instrument (Nut. Div.) Copper
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 2 PKR
Copper sulphate (Nut. Div.) Copper sulfate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 238 PKR
Copper sulphate (Merck /BDH) (Nut. Div.) Copper sulfate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/g
100/g 1188 PKR
Cupric carbonate (Nut. Div.) Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 2 PKR
Cupric sulphate pentahydrate (Merck /BDH) (Nut. Div.) Chromic chloride/cupric sulfate/manganese sulfate/selenium/zinc
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Di sodium EDTA (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Diethyl ether (Nut. Div.) Diethyl ether or ether
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 12/Qty
12/Qty 71 PKR
Dimethylglyoxim (Nut. Div.) Didecyldimethylammonium chloride
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 1188 PKR
Diphenyl carbazide (Merck /BDH) (Nut. Div.) Diphenylhydantoin test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 300/g
300/g 713 PKR
Diphenylthiocarbazone (Merck /BDH) (Nut. Div.) Diphenylhydantoin test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/g
100/g 238 PKR
Dissolved Oxygen HANNA Instrument (Nut. Div.) Dissolved oxygen meters
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
EDTA AR Grade (Merck/ equivalent) (Nut. Div.) Benzalkonium chloride/edta
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Kg
10/Kg 24 PKR
Ferric chloride (Nut. Div.) Ferric chloride colorimetric preparation
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Ferric chloride (Merck /BDH) (Nut. Div.) Ferric chloride colorimetric preparation
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Ferric citrate (Nut. Div.) Ferric chloride colorimetric preparation
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 1188 PKR
Florisil (Nut. Div.) Dried cut french florissa tulip
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 453/g
453/g 1076 PKR
Flouride Test Kit (Nut. Div.) Blood bank test kits or supplies
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Fluoride Test Kit (Merck/ equivalent) (Nut. Div.) Androgeny and fertility test kits and supplies
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
Formaldehyde (Nut. Div.) Aluminum chlorohydrex/formaldehyde/menthol/zinc undecylenate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 6 PKR
Foroglucinol (Merck /BDH) (Nut. Div.) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/g
100/g 238 PKR
Glucose (Merck /BDH) (Nut. Div.) Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Glycerin (AR grade) Scharlau/ equivalent (Nut. Div.) Acetic acid/antipyrine/benzocaine/glycerin
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Ltr
5/Ltr 12 PKR
Hydrochloric Acid (Merck /Eq.) (Nut. Div.) Hydrochloric acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Ltr
5/Ltr 12 PKR
Hydrochloric Acid (conc) (AR grade) (Merck /BDH/ equivalent) (Nut. Div.) Hydrochloric acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 89 PKR
Hydrogen peroxide (Nut. Div.) Carbamide peroxide or hydrogen peroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Qty
10/Qty 59 PKR
Hydrogen peroxide (AR grade) Scharlau/ equivalent (Nut. Div.) Carbamide peroxide or hydrogen peroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Ltr
10/Ltr 24 PKR
Iodine crystals (Merck /BDH) (Nut. Div.) Calcium/iodine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Iodine HANNA Instrument (Nut. Div.) Calcium/iodine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Iron HR HANNA Instrument (Nut. Div.) Iron Fe
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Kaliumdichromate (Nut. Div.) Chromate standards
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Kaliumjodid reinst (Nut. Div.) Acid or alkali resistant castable
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Lead chromate (Merck /BDH) (Nut. Div.) Chromate standards
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1.5/Kg
1.5/Kg 4 PKR
Magnesium HANNA Instrument (Nut. Div.) Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Magnesium Sulfate (Merck/BDH) (Nut. Div.) Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Magnesium Sulfate Ar Grade (Merck /BDH) / (Nut. Div.) equivalent Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Kg
5/Kg 12 PKR
Magnesium sulfate hepta hydrate (Merck /BDH) (Nut. Div.) Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Magnesium system reagent Thermoscientific (Nut. Div.) Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Magnesium Test Kit (Merck/Equivalent) (Nut. Div.) Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
Manganese HR HANNA Instrument (Nut. Div.) Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Megnisumnitrat (Nut. Div.) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Methanol (HPLC grade) (Nut. Div.) Methanol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
Methyl orange indicator (Nut. Div.) 3-methylmorphine or codeine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1.5/Kg
1.5/Kg 4 PKR
Methyl red (Nut. Div.) 3-methylmorphine or codeine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Methyl Red ( AR grade) (Merck /BDH) (Nut. Div.) 3-methylmorphine or codeine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1.5/Kg
1.5/Kg 2 PKR
Methylene blue (Nut. Div.) 3,4-methylenedioxyphenyl-2-propanone
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 4 PKR
Methylene blue (Merck /BDH) (AR grade) (Nut. Div.) 3,4-methylenedioxyphenyl-2-propanone
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1.5/Kg
1.5/Kg 2 PKR
Natrium hydrogen carbonates (Nut. Div.) 6-phosphogluconate dehydrogenase test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 25/Kg
25/Kg 4 PKR
Natrium oxalate (Nut. Div.) B-type natriuretic peptide test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 59 PKR
n-hexane (HPLC grade) (Nut. Div.) Nandrolone cyclohexanecarboxylate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 12/Qty
12/Qty 2 PKR
Nickel HR HANNA Instrument (Nut. Div.) Cast coated anisotropic ferrous aluminum nickel cobalt magnet
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 71.26 PKR
Nitrate HANNA Instrument (Nut. Div.) Aminoethyl nitrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Nitrate kit thermoscientific (Nut. Div.) Aminoethyl nitrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Nitric Acid (AR grade) (Nut. Div.) The diagnosis of toxic effect of nitroglycerin and nitric acids and esters
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 12/Qty
12/Qty 71 PKR
Nitrite HR HANNA Instrument (Nut. Div.) Amyl nitrite/sodium nitrite/sodium thiosulfate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Nitrium chloride (Nut. Div.) Calcium/chloride/gluconate/magnesium/potassium/sodium/sulfate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Ozone HANNA Instrument (Nut. Div.) Ozone analyzers
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Pepsin (Nut. Div.) Amylase/bile salts/dehydrocholic acid/lipase/pepsin/proteolytic
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Petroleum ether (40-60 oC) (AR grade) (Nut. Div.) Petroleum or chemical trucking service
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 60/Qty
60/Qty 356 PKR
pH Buffer Tablet (10.00 + 0.02) BDH / equivalent (Nut. Div.) Buffer solutions
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
PH buffer tablet (4.0+0.02) BDH / equivalent (Nut. Div.) Buffer solutions
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
pH Buffer Tablet (7.00 + 0.02) BDH / equivalent (Nut. Div.) Buffer solutions
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
Phenolphthalein indicator (Nut. Div.) Bisacodyl/magnesium citrate/phenolphthalein
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Phenolphthalein indicator (Merck /BDH) (Nut. Div.) Bisacodyl/magnesium citrate/phenolphthalein
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/g
100/g 238 PKR
Pholoroglucinol (Merck /BDH) (Nut. Div.) Diagnosis of isolated proteinuria with specified morphological lesion, dense deposit disease
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Phosphate HR HANNA Instrument (Nut. Div.) Acid phosphatase
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Phosphomolybdic Acid (Merck /BDH) (Nut. Div.) 2,3-diphosphoglyceric acid test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Phosphorus penta Oxide (AR grade) Scharlau/ equivalent (Nut. Div.) Diagnosis of disorders of phosphorus metabolism and phosphatases
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Kg
5/Kg 12 PKR
Ploroglucinol (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.) Exploration or development system spare parts or accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Kg
5/Kg 12 PKR
Potassium Chloride AR grade (Merck/ BDH) / equivalent (Nut. Div.) Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Kg
10/Kg 24 PKR
Potassium Chloride (Merck/ BDH) (Nut. Div.) Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Kg
4/Kg 10 PKR
Potassium Chromate AR Grade (Merck /BDH) / equivalent (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Kg
10/Kg 24 PKR
Potassium dichromate (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Potassium ferricyanide (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Potassium ferricyanide (Merck /BDH) (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2.5/Kg
2.5/Kg 6 PKR
Potassium HANNA Instrument (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Potassium hydrogen phthalate (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 1188 PKR
Potassium Hydroxide (AR grade) Scharlau/ equivalent (Nut. Div.) Potassium hydroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 7/Kg
7/Kg 17 PKR
Potassium Iodide (Scharlau) (Nut. Div.) Aminophylline/ephedrine/phenobarbital/potassium iodide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1.5/Kg
1.5/Kg 4 PKR
Potassium sodium tartrate (Nut. Div.) Potassium sodium tartrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Resorcinol (Nut. Div.) Acetone/basic fuchsin/boric acid/resorcinol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Resorcinol (Merck /BDH) (Nut. Div.) Acetone/basic fuchsin/boric acid/resorcinol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1000/ml
1000/ml 2376 PKR
Salicylasure gefallt (Nut. Div.) Aceclidine salicylate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Silica gel (Nut. Div.) Silica gel
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Silver nitrate AR Grade (Merck/ equivalent) (Nut. Div.) Silver nitrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 7/Kg
7/Kg 17 PKR
Sodium acetate (Merck /BDH) (Nut. Div.) Sodium acetate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Sodium benzoate (Nut. Div.) Caffeine/sodium benzoate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 1188 PKR
Sodium bicarbonate (Merck /Equivalent) (Nut. Div.) Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Sodium bisulfate (Merck /BDH) (Nut. Div.) Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 200/g
200/g 475 PKR
Sodium carbonate (Merck /BDH) Boric acid/potassium chloride/sodium carbonate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Sodium Chloride (AR grade) Scharlau/ equivalent (Nut. Div.) Aminophylline/sodium chloride
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 12/Kg
12/Kg 29 PKR
Sodium chromate (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Sodium hydroxide (Merck /BDH) (Nut. Div.) Sodium hydroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 12/Kg
12/Kg 29 PKR
Sodium sulphate (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Sodium thiosulphate (Merck /BDH) (Nut. Div.) Amyl nitrite/sodium nitrite/sodium thiosulfate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Sodium tungtate (Merck /BDH) (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/g
100/g 238 PKR
SPADNS, sodium 2-(parasulfophenylazo)-1,8-dihydroxy-3,6-naphthalene disulfonate, also called 4,5-dihydroxy-3-(parasulfophenylazo)-2,7 naphthalenedisulfonic acid trisodium salt (Nut. Div.) Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Kg
5/Kg 12 PKR
Standard/Calibrator each of Na, K, Ca (1000 ppm or 500 ppm) (Nut. Div.) Androgeny and fertility quality controls and calibrators and standards
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Starch soluble (AR grade) (Nut. Div.) Benzethonium chloride/corn starch/kaolin/zinc oxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Kg
2/Kg 5 PKR
Sucrose (Nut. Div.) Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Sucrose (Merck /BDH) (Nut. Div.) Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Sulfate HANNA Instrument (Nut. Div.) Alcohol/sulfur/zinc oxide/zinc sulfate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Sulphate kit thermoscientific (Nut. Div.) Sodium thiosulfate or thiosulfate or thiosulphate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Sulphuric Acid (conc) (AR grade) (Merck / BDH). (Nut. Div.) Sulphuric acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 15/Qty
15/Qty 89 PKR
Total Chlorine HANNA Instrument (Nut. Div.) Chlorine Cl
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
Tri chloro acetic acid (Nut. Div.) Acetic acid/benzalkonuim chloride/chloroxylenol/glycerin
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 5 PKR
Trifluoro Acetic Acid (AR grade) (Nut. Div.) 5-hydroxyindole acetic acid/serotonin test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Ltr
10/Ltr 24 PKR
Urea (Merck /BDH) (Nut. Div.) Urea UF
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Kg
1/Kg 2 PKR
Zinc acetate (Merck /BDH) (Nut. Div.) Diphenhydramine/zinc acetate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1.5/Kg
1.5/Kg 4 PKR
Zinc HANNA Instrument (Nut. Div.) Alcohol/benzoic acid/boric acid/zinc oxide/zinc stearate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/box
3/box 7 PKR
MacConkey agar purple CV (oxide eq) (Nut. Div.) Chemical or pharmaceutical machinery or equipment manufacture services
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 4751 PKR
Plate count agar (Nut. Div.) Polymerase chain reaction PCR tube strip and plate cooler
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Qty
10/Qty 11878 PKR
Bismuth sulphite agar (Nut. Div.) Benzocaine/bismuth subgallate/phenylmecuric nitrate/zinc oxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 3563 PKR
XLD agar (Nut. Div.) Agar-agar
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 2376 PKR
Sabouraud Dextrose agar (Nut. Div.) Anticoagulant citrate phosphate dextrose solution
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 2376 PKR
Simmons citrate agar (Nut. Div.) Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 1188 PKR
Mannitol salt agar (Nut. Div.) Amifostine/mannitol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 4751 PKR
Nutrient agar (Nut. Div.) Nutrients
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 1188 PKR
Tryptone soya agar (Nut. Div.) Tryptophan
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 1188 PKR
Motility agar (Nut. Div.) Measurement of gastrointestinal motility, via natural or artificial opening
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 1188 PKR
EMB agar (Nut. Div.) Agar-agar
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 4751 PKR
TCBS agar (Nut. Div.) Agar-agar
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 1188 PKR
Peptone water (Nut. Div.) Water
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 12/Qty
12/Qty 14254 PKR
MacConkey broth purple CV-3 (Nut. Div.) Mine action center MAC or mine action coordination center MACC service
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Qty
10/Qty 11878 PKR
BGLB 20% (Nut. Div.) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 6/Qty
6/Qty 7127 PKR
MR-VP broth (Nut. Div.) Bottled broth media for bacteria
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 1188 PKR
Hydrogen peroxide 30% (Nut. Div.) Carbamide peroxide or hydrogen peroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 475 PKR
Kovac's reagent (Nut. Div.) Acid, alcohol, and decolorizing fluid reagents
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 713 PKR
Oxidase reagent (Nut. Div.) Diagnosis of defects of catalase and peroxidase
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 475 PKR
Emulsion oil (Nut. Div.) Emulsions
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 475 PKR
Barritt reagent-A (Nut. Div.) Acetic acid, alcohol, and toluidine blue combination reagents
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 238 PKR
Barritt reagent-B (Nut. Div.) Acetic acid, alcohol, and toluidine blue combination reagents
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 238 PKR
Methylated Spirit (Nut. Div.) Camphor/eucalyptus oil/menthol/turpentine spirits
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 50/Ltr
50/Ltr 119 PKR
Catalase test (Sigma Aldrich) (CMLT) Diagnosis of defects of catalase and peroxidase
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/ml
500/ml 1188 PKR
Oxidase test (Biomerieux) (CMLT) Leukocyte peroxidase test
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/ml
500/ml 1188 PKR
Ziehl Neelsen (Diacheme) (CMLT) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/set
1/set 2 PKR
Field Stain set(Diacheme) (CMLT) Field strength measuring equipment
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/ml
500/ml 1188 PKR
Spirit Lamp (CMLT) Camphor/eucalyptus oil/menthol/turpentine spirits
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Ltr
3/Ltr 7 PKR
Disposable gloves (Nylon) (CMLT) Chemical resistant gloves
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/pack
5/pack 12 PKR
HCV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
HBs Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
HBs Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
HBe Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
HBe Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
HBc IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6-12 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
HB core IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
HAV Ab IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
HEV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 228 PKR
Toxoplasma IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Basic Diagnostic Procedures
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
Toxoplasma IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6-12 months\ CE-IVD/FDA approved 96 test (PHLD) Diagnosis of toxoplasma hepatitis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
Rubella IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Diagnoses of rubella without complication
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
Rubella IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Diagnoses of rubella without complication
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
CMV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
CMV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
HSV IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
HSV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 2053 PKR
Measles IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Diagnoses of measles complicated by encephalitis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 2053 PKR
Measles IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Diagnoses of measles complicated by encephalitis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
Mumps IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Diagnoses of mumps pancreatitis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 912 PKR
Mumps IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Diagnoses of mumps pancreatitis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 228 PKR
VZV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 228 PKR
VZV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
EBV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 912 PKR
HIV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
Rabies Ab titer, Biorad/equivalent Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD) Diagnosis of sylvatic rabies
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 3649 PKR
Dengue Virus IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD) Diagnosis of dengue haemorrhagic fever
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 5701 PKR
Dengue Virus IgG ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD) Diagnosis of dengue haemorrhagic fever
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
Dengue Virus NS1 ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved. Detection of suspected target organism should be in one well 96 test Diagnoses of dengue fever or classical dengue
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 4561 PKR
Dengue Virus IgG/IgM and NS1, Combo Rapid Test Kit(Qualitative) Should include all reagents Shelf life 6-12 months CE-IVD/FDA approved 25 test (PHLD) Diagnoses of dengue fever or classical dengue
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 20/Qty
20/Qty 23756 PKR
West Nile Fever Virus IgM ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD) Diagnosis of west nile virus infection
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 228 PKR
Japanese Encephalitis IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD) Diagnoses of australian encephalitis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
Mpox Virus Realtime-PCR Kit (Qualitative) positive and negative control, Must Detect both Clades (I &II) Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 48 test (PHLD) Diagnosis of acute bronchiolitis due to human metapneumovirus
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 2851 PKR
CCHFV Realtime-PCR Kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 3649 PKR
Triplex Realtime-PCR kit for Dengue, Chikungunya & Zika Virus Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) Triplex pumps
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 3649 PKR
Oropouche Virus Real Time PCR kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA/RUO approved For Human Specimen 96 test (PHLD) Diagnoses of oropouche virus disease
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
Filo Virus Realtime-PCR Kits (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) Butofilolol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 228 PKR
West Nile Fever Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) Diagnosis of west nile virus infection
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 228 PKR
Varicella-Zoster Virus Realtime-PCR Kit (Qualitative) positive and negative control shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) Diagnosis of disseminated zoster
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
CMV Real Time PCR kit (Qualitative) positive and negative control: Shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test. (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 228 PKR
HSV Real Time Kit (Qualitative) Must Identify HSV-1 and HSV-2 in single reaction positive and negative control shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen 96 test (PHLD) Oilfield real time well data monitoring services
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 912 PKR
Rabies Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD) Rabies vaccine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 228 PKR
Realtime-PCR Kit of Hepatitis B Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Oilfield real time well data monitoring services
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Realtime-PCR Kit of Hepatitis C Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved\ I Oilfield real time well data monitoring services
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Trioplex Realtime -PCR Kit for SARS-CoV-2, Flu A & B, RSV, Target Pathogens: SARS-CoV-2, Influenza A (including H1N1 and H3N2), Influenza B, Respiratory Syncytial Virus (RSV A/B) Specimen Type: Nasopharyngeal swabs, oropharyngeal swabs Internal Cont Oilfield real time well data monitoring services
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Qty
10/Qty 228 PKR
Positive Control for Oropouche Virus Type: Inactivated virus / Plasmid control Form: Lyophilized Purpose: Use as a positive control in molecular diagnostic assays (e.g., real-time RT-PCR, conventional RT-PCR) for OROV Volume: Minimum 100µL per via Diagnoses of oropouche virus disease
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/Qty
100/Qty 2 PKR
MAYV_FNF, 5’-CACGGACMTTTTGCCTTCA 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 228 PKR
MAYV_FNR, 5’-AGACTGCCACCTCTGCTKGAG 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 2 PKR
MAYV_FNP, 5’-VIC-ACAGATCAGACATGCAGG-NFQ-MGB 200nm HPLC (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
OROV_FNF,5’-TCCGGAGGCAGCATATGTG 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
OROV_FNR, 5’-ACAACACCAGCATTGAGCACTT 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
OROV_FNP, 5’-FAM-CATTTGAAGCTAGATACGG-NFQ-MGB 200nm HPLC (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
NF5,TGAGTGCTCTCCAACTTCTGCAGT 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
NR5,TTCTTCAGAGCTTGCATCTTGAT 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
PF1,TTTAATCGACATGGGAGCAATTG 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
PR1, TAAGGTGGGTCAGACGGAGAGA 50nm DeSalt (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
TaqMan MGB Probe, VIC-AGAATTCATCCTGGCAGCT-NFQ 200 nm HPLC (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
RA Factor Latex 100 tests(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 20/Qty
20/Qty 48 PKR
CRP Latex 100 tests(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 20/Qty
20/Qty 48 PKR
Anti IgA Ab ( Manual Elisa )(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 15/Qty
15/Qty 36 PKR
Anti CCP IgGAb ( Manual Elisa)(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 7/Qty
7/Qty 17 PKR
ANA IgG kit Elisa (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 5 PKR
BrucellaAb Latex 100 tests(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 5 PKR
ASO Titter Latex 100 tests(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
ICT MP Devices(PHLD) Altitude measuring devices
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/Qty
100/Qty 238 PKR
Anti TTG IgG Elisa Manual(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 15/Qty
15/Qty 36 PKR
Anti DeaminatedgladinAb ( Elisa ) DGP IgG(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 15/Qty
15/Qty 36 PKR
H Pylori for stool Antigen Devices (PHLD) Diagnosis of adult hypertrophic pyloric stenosis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 800/Qty
800/Qty 1900 PKR
Total Immunoglobulin A Elisa kit(PHLD) Bacterial immunoglobulins
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
VDRL Latex kit 100 tests(PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 7 PKR
H Pylori IgM Antibodies Elisa kit 96 tests(PHLD) Diagnosis of adult hypertrophic pyloric stenosis
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 8/Qty
8/Qty 19 PKR
Urine Pregnancy Kit (PHLD) The diagnosis of extravasation of urine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/Qty
100/Qty 238 PKR
Occult Blood Kit (PHLD) Occult blood test
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/Qty
100/Qty 238 PKR
Streptococcus grouping kit (Thermo) (PHLD) Diagnosis of acute bronchitis due to streptococcus
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 238 PKR
G6PD Test Kit (Qualitative Method) (Span Diagnostics, France) (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Qty
10/Qty 5 PKR
ABO Blood Grouping Kit, (Atlas Medical, Germany) (03x10ml/kit) (PHLD) Kits or enzymes for sequencing
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 6/Qty
6/Qty 24 PKR
Absolute ethanol, molecular biology grade (2.5 liter Pack) (PHLD) Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Qty
10/Qty 14 PKR
Sodium hypochlorite Solution) 100% (PHLD) Benzalkonium chloride/edetate/sodium hydroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 10/Ltr
10/Ltr 24 PKR
Medium RPMI 1640 (!X) Without L-Glutamine Ref No 21870-076, Lot No. 2518007 Gibco company 500 ml (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 7 PKR
Phytohaemagglutinin (PHA)- CAT No. 151884-MP Biomedicals, LLC (Pack of 10mg)(PHLD) Phytotron
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
Fetal Bovine Serum (FBS) (Pack of 100 ml) (PHLD) Bovine semen
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Penicillin Streptomycin (PSS) ICN/ Sigma /Equivalent (Pack of 100 ml) (PHLD) Adicillin or penicillin n
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
L-Glutamine (ICN, Cat No. 16-801049) (Pack of 100 ml) (PHLD) Glutamine
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Ethanol (Merck/BDH/Equal) (Pack of 2.5 lit) Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Methanol (Merck/BDH/Equal) (Pack of 2.5 lit) (PHLD) Methanol
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 5 PKR
Glycerin (Pack of 2.5 lit)(PHLD) Acetic acid/antipyrine/benzocaine/glycerin
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Acetic Acid Ct No 40766363-Merk (Pack of 2.5 lit) (PHLD) Acetic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Nuclease free water Invitrogen Ultra Pure Distilled Water Dnase/RNase free (500ml) (PHLD) Chloramphenicol/desoxyribonuclease/fibrinolysin
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 15/Qty
15/Qty 36 PKR
Absolute Ethanol (2.5L) (PHLD) Benzocaine/chlorobutanol/ethanol/menthol/tannic acid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 4/Qty
4/Qty 10 PKR
PCR Tubes with strips (0.2ml) thin walled PCR Tubes strip with indidual flat cap Dnase,RNase and pyrogen free 120 strip/Pack NEST Biotechnology (PHLD) Polymerase chain reaction PCR tube strip and plate cooler
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 20/Qty
20/Qty 48 PKR
Anaerobic gas pack( pack of 10) (PHLD) Anaerobic jars or accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/pack
2/pack 5 PKR
Potassium hydroxide (PHLD) Potassium hydroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/g
500/g 1188 PKR
Potassium Tellurite` Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 25/g
25/g 59 PKR
(HCL) concentrated (PHLD) Bisacodyl/docusate/senna concentrate/senna extract/sucrose
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2.5/Ltr
2.5/Ltr 6 PKR
Hydrogen Peroxide (PHLD) Carbamide peroxide or hydrogen peroxide
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/ml
500/ml 1188 PKR
Glycerin (Glycerol) 87%, Merck (Pack of 2.5) (PHLD) Acetic acid/antipyrine/benzocaine/glycerin
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 3/Qty
3/Qty 7 PKR
Hand Disinfectant/ Antiseptic (PHLD) Dialysate delivery system disinfectants
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 24/Qty
24/Qty 57 PKR
Hypochlorite (KOSDAQ ) 6-14% (PHLD) Sodium hypochlorite
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 24/Kg
24/Kg 57 PKR
Culti Loops Thermofisher or equivalent ATCC 49226 Neisseria gonorrhoeae (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Culti Loops Thermofisher or equivalent ATCC 43300 S. aureus methicillin resistant control (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Culti Loops Thermofisher or equivalent ATCC 27853Peudomonasaeruginosa (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Culti Loops Thermofisher or equivalent ATCC 25922 E.coli (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Culti Loops Thermofisher or equivalent ATCC 19615 S.pyogenes (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Culti Loops Thermofisher or equivalent ATCC 27012 C. diphtheria (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Culti Loops Thermofisher or equivalent ATCC 27010 C. diphtheria (PHLD) Industrial chemical equipment spare parts and accessories
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 1/Qty
1/Qty 2 PKR
Bovine Albumin 22 %(Atlas Medical, Germany) ( Pack of 10ml) (PHLD) Bovine production services
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Qty
2/Qty 5 PKR
Anti-Human Globulin(Atlas Medical, Germany) ( Pack of 10ml) (PHLD) Alpha-2-macroglobulin immunological test system
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/pack
2/pack 5 PKR
Hand Sanitizer (liquid)(OROSEPT Solution) ( Pack of 500ml) (PHLD) Hand sanitizer
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 5/Qty
5/Qty 12 PKR
Immersion Oil for Microscopy, (Sigma-Aldrich Co., USA) ( Pack of500ml) (PHLD) Microscope immersion oil
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 500/ml
500/ml 1188 PKR
Reticulocyte Count Stain ( Pack of 100 ml) (Diachem ) (PHLD) Diagnosis of actinic reticuloid
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 100/ml
100/ml 238 PKR
Giemsa Stain (Pack of 1000ml) (Merck, KGaA, Germany) (PHLD) Alloy steel/stainless steel check valve
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 2/Ltr
2/Ltr 8 PKR
Spirit (PHLD) Spirits or liquors
Address: Park Road, Islamabad Capital Territory Schedule: 27 Days Quantity: 200/Ltr
200/Ltr 297371 PKR

Related Services of Goods:

No

Items/Lot Specification

Items Without Lots :

Item: Spirit Rectified, (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)

UNSPSC: Spirits or liquors

Specifications / Requirementsss:

Spirit Rectified, (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)

Item: Chloroform (AR grade), (Merck / BDH/ Equivalent) (Nut. Div.)

UNSPSC: Chloroform

Specifications / Requirementsss:

Chloroform (AR grade), (Merck / BDH/ Equivalent) (Nut. Div.)

Item: (AR grade) (Merck /BDH/ equivalent) NH4 OH (Nut. Div.)2.5 ltr

UNSPSC: Chemical management service

Specifications / Requirementsss:

(AR grade) (Merck /BDH/ equivalent) NH4 OH (Nut. Div.)

Item: (Merck / BDH/ equipment) (Nut. Div.)

UNSPSC: Equipment inspection service

Specifications / Requirementsss:

(Merck / BDH/ equipment) (Nut. Div.)

Item: (Merck / BDH/ Equivalent (Nut. Div.)

UNSPSC: Equipment inspection service

Specifications / Requirementsss:

(Merck / BDH/ Equivalent (Nut. Div.)

Item: Absolute Ethanol (AR grade) (Nut. Div.)

UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid

Specifications / Requirementsss:

Absolute Ethanol (AR grade) (Nut. Div.)

Item: Acetic Acid Glacial (AR grade) (Nut. Div.)

UNSPSC: Acetic acid

Specifications / Requirementsss:

Acetic Acid Glacial (AR grade) (Nut. Div.)

Item: Acetic Acid Glacial (AR grade) Scharlau/ equivalent (Nut. Div.)

UNSPSC: Acetic acid

Specifications / Requirementsss:

Acetic Acid Glacial (AR grade) Scharlau/ equivalent (Nut. Div.)

Item: Acetone GC grade (Merck /BDH) (Nut. Div.)

UNSPSC: Acetone/alcohol

Specifications / Requirementsss:

Acetone GC grade (Merck /BDH) (Nut. Div.)

Item: Acetonitrile (Nut. Div.)

UNSPSC: Acetonitrile

Specifications / Requirementsss:

Acetonitrile (Nut. Div.)

Item: Acidum formicium (Nut. Div.)

UNSPSC: 2,3-diphosphoglyceric acid test system

Specifications / Requirementsss:

Acidum formicium (Nut. Div.)

Item: Agra Strip Pro (Total Aflatoxin) Romer Lab (Nut. Div.)

UNSPSC: Binding combs or strips

Specifications / Requirementsss:

Agra Strip Pro (Total Aflatoxin) Romer Lab (Nut. Div.)

Item: Alkalinity HANNA Instrument (Nut. Div.)

UNSPSC: Alkaline phosphatase or isoenzymes test system

Specifications / Requirementsss:

Alkalinity HANNA Instrument (Nut. Div.)

Item: Aluminum HANNA Instrument (Nut. Div.)

UNSPSC: Acetaminophen/aluminum acetate/chlorpheniramine/phenylpropanolam

Specifications / Requirementsss:

Aluminum HANNA Instrument (Nut. Div.)

Item: Aluminum oxid (Nut. Div.)

UNSPSC: Aluminum oxide

Specifications / Requirementsss:

Aluminum oxid (Nut. Div.)

Item: Ammonia HR HANNA Instrument (Nut. Div.)

UNSPSC: Ammonia

Specifications / Requirementsss:

Ammonia HR HANNA Instrument (Nut. Div.)

Item: Ammonium Chloride (Merck / BDH) (Nut. Div.)

UNSPSC: Aminophylline/ammonium chloride/diphenhydramine

Specifications / Requirementsss:

Ammonium Chloride (Merck / BDH) (Nut. Div.)

Item: Ammonium Hydroxide (conc) (Nut. Div.)

UNSPSC: Ammonium hydroxide titrants

Specifications / Requirementsss:

Ammonium Hydroxide (conc) (Nut. Div.)

Item: Ammonium molybdate (Merck /BDH) (Nut. Div.)

UNSPSC: Aminophylline/ammonium chloride/diphenhydramine

Specifications / Requirementsss:

Ammonium molybdate (Merck /BDH) (Nut. Div.)

Item: Amyl alcohol (Nut. Div.)2.5ltr

UNSPSC: Acetone/alcohol

Specifications / Requirementsss:

Amyl alcohol (Nut. Div.)

Item: Anhydrous Sodium Fluoride (Nut. Div.)

UNSPSC: Calcium carbonate/sodium fluoride

Specifications / Requirementsss:

Anhydrous Sodium Fluoride (Nut. Div.)

Item: Antifoam tablets (Nut. Div.)

UNSPSC: Anti foaming agents

Specifications / Requirementsss:

Antifoam tablets (Nut. Div.)

Item: Arsenic Test Supelco Kit (Nut. Div.)

UNSPSC: Arsenic test system

Specifications / Requirementsss:

Arsenic Test Supelco Kit (Nut. Div.)

Item: Ascorbic Acid (AR grade) (Nut. Div.)

UNSPSC: Ascorbic acid

Specifications / Requirementsss:

Ascorbic Acid (AR grade) (Nut. Div.)

Item: Barium Chloride (Merk /BDH) (Nut. Div.)

UNSPSC: Barium Ba

Specifications / Requirementsss:

Barium Chloride (Merk /BDH) (Nut. Div.)

Item: Barium Chloride AR Grade (Merck/ BDH) / equivalent (Nut. Div.)

UNSPSC: Barium Ba

Specifications / Requirementsss:

Barium Chloride AR Grade (Merck/ BDH) / equivalent (Nut. Div.)

Item: Benzoic acid (Nut. Div.)

UNSPSC: 4-aminobenzoic acid or Aminobenzoic acid or PABA or para-aminobenzoic acid

Specifications / Requirementsss:

Benzoic acid (Nut. Div.)

Item: Boric Acid (AR grade) (Nut. Div.)

UNSPSC: Acetone/basic fuchsin/boric acid/resorcinol

Specifications / Requirementsss:

Boric Acid (AR grade) (Nut. Div.)

Item: Bromine HANNA Instrument (Nut. Div.)

UNSPSC: Bromine Br

Specifications / Requirementsss:

Bromine HANNA Instrument (Nut. Div.)

Item: Bromocresol green (Nut. Div.)

UNSPSC: Bromocriptine

Specifications / Requirementsss:

Bromocresol green (Nut. Div.)

Item: Bromocresol green (Merck /BDH) (Nut. Div.)

UNSPSC: Bromocriptine

Specifications / Requirementsss:

Bromocresol green (Merck /BDH) (Nut. Div.)

Item: Bromocresol purple (Merck /BDH) (Nut. Div.)

UNSPSC: Bromocriptine

Specifications / Requirementsss:

Bromocresol purple (Merck /BDH) (Nut. Div.)

Item: Bromophenol blue (Nut. Div.)

UNSPSC: Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium

Specifications / Requirementsss:

Bromophenol blue (Nut. Div.)

Item: Bromothymol Blue (BTB) (Nut. Div.)

UNSPSC: Ammonium/bromodiphenhydramine/codeine/diphenhydramine/potassium

Specifications / Requirementsss:

Bromothymol Blue (BTB) (Nut. Div.)

Item: Calcium carbonate (Nut. Div.)

UNSPSC: Acetaminophen/aspirin/calcium carbonate

Specifications / Requirementsss:

Calcium carbonate (Nut. Div.)

Item: Calcium Carbonate (Merck/ equivalent) (Nut. Div.)

UNSPSC: Acetaminophen/aspirin/calcium carbonate

Specifications / Requirementsss:

Calcium Carbonate (Merck/ equivalent) (Nut. Div.)

Item: Calcium Colorimetric assay kits (Nut. Div.)

UNSPSC: Calcium

Specifications / Requirementsss:

Calcium Colorimetric assay kits (Nut. Div.)

Item: Calcium HANNA Instrument (Nut. Div.)

UNSPSC: Calcium

Specifications / Requirementsss:

Calcium HANNA Instrument (Nut. Div.)

Item: Calcium Marine HANNA Instrument (Nut. Div.)

UNSPSC: Calcium

Specifications / Requirementsss:

Calcium Marine HANNA Instrument (Nut. Div.)

Item: Calcium oxide (Nut. Div.)

UNSPSC: Calcium oxide

Specifications / Requirementsss:

Calcium oxide (Nut. Div.)

Item: Catalyst tablets for kjeldahl method (Nut. Div.)

UNSPSC: Acid catalysts

Specifications / Requirementsss:

Catalyst tablets for kjeldahl method (Nut. Div.)

Item: CDTA (Cyclohexylenediaminetetraacetic acid) (Nut. Div.)

UNSPSC: Nandrolone cyclohexylpropionate

Specifications / Requirementsss:

CDTA (Cyclohexylenediaminetetraacetic acid) (Nut. Div.)

Item: Charcoal (Nut. Div.)

UNSPSC: Charcoal

Specifications / Requirementsss:

Charcoal (Nut. Div.)

Item: Chlorine Test Kit 6991 LP-DPD Tablets Octet Comparator 0.01 to 1 Ppm and 1.0 to 6.0 Ppm (LA Motte/ Equivalent) (Nut. Div.)

UNSPSC: Chlorine Cl

Specifications / Requirementsss:

Chlorine Test Kit 6991 LP-DPD Tablets Octet Comparator 0.01 to 1 Ppm and 1.0 to 6.0 Ppm (LA Motte/ Equivalent) (Nut. Div.)

Item: Chloroform (AR grade) (Nut. Div.)

UNSPSC: Chloroform

Specifications / Requirementsss:

Chloroform (AR grade) (Nut. Div.)

Item: Choarcoal activated AR grade (Nut. Div.)

UNSPSC: Charcoal

Specifications / Requirementsss:

Choarcoal activated AR grade (Nut. Div.)

Item: Chromium Vi LR HANNA Instrument (Nut. Div.)

UNSPSC: Chromium Cr

Specifications / Requirementsss:

Chromium Vi LR HANNA Instrument (Nut. Div.)

Item: Citric acid (Nut. Div.)

UNSPSC: Alcohol/citric acid/salicylic acid

Specifications / Requirementsss:

Citric acid (Nut. Div.)

Item: Citric Acid (Commercial grade) (Nut. Div.)

UNSPSC: Alcohol/citric acid/salicylic acid

Specifications / Requirementsss:

Citric Acid (Commercial grade) (Nut. Div.)

Item: Copper acetate (Nut. Div.)

UNSPSC: Copper

Specifications / Requirementsss:

Copper acetate (Nut. Div.)

Item: Copper acetate(Merck /BDH) (Nut. Div.)

UNSPSC: Copper

Specifications / Requirementsss:

Copper acetate(Merck /BDH) (Nut. Div.)

Item: Copper HR HANNA Instrument (Nut. Div.)

UNSPSC: Copper

Specifications / Requirementsss:

Copper HR HANNA Instrument (Nut. Div.)

Item: Copper sulphate (Nut. Div.)

UNSPSC: Copper sulfate

Specifications / Requirementsss:

Copper sulphate (Nut. Div.)

Item: Copper sulphate (Merck /BDH) (Nut. Div.)

UNSPSC: Copper sulfate

Specifications / Requirementsss:

Copper sulphate (Merck /BDH) (Nut. Div.)

Item: Cupric carbonate (Nut. Div.)

UNSPSC: Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride

Specifications / Requirementsss:

Cupric carbonate (Nut. Div.)

Item: Cupric sulphate pentahydrate (Merck /BDH) (Nut. Div.)

UNSPSC: Chromic chloride/cupric sulfate/manganese sulfate/selenium/zinc

Specifications / Requirementsss:

Cupric sulphate pentahydrate (Merck /BDH) (Nut. Div.)

Item: Di sodium EDTA (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Di sodium EDTA (Nut. Div.)

Item: Diethyl ether (Nut. Div.)

UNSPSC: Diethyl ether or ether

Specifications / Requirementsss:

Diethyl ether (Nut. Div.)

Item: Dimethylglyoxim (Nut. Div.)

UNSPSC: Didecyldimethylammonium chloride

Specifications / Requirementsss:

Dimethylglyoxim (Nut. Div.)

Item: Diphenyl carbazide (Merck /BDH) (Nut. Div.)

UNSPSC: Diphenylhydantoin test system

Specifications / Requirementsss:

Diphenyl carbazide (Merck /BDH) (Nut. Div.)

Item: Diphenylthiocarbazone (Merck /BDH) (Nut. Div.)

UNSPSC: Diphenylhydantoin test system

Specifications / Requirementsss:

Diphenylthiocarbazone (Merck /BDH) (Nut. Div.)

Item: Dissolved Oxygen HANNA Instrument (Nut. Div.)

UNSPSC: Dissolved oxygen meters

Specifications / Requirementsss:

Dissolved Oxygen HANNA Instrument (Nut. Div.)

Item: EDTA AR Grade (Merck/ equivalent) (Nut. Div.)

UNSPSC: Benzalkonium chloride/edta

Specifications / Requirementsss:

EDTA AR Grade (Merck/ equivalent) (Nut. Div.)

Item: Ferric chloride (Nut. Div.)

UNSPSC: Ferric chloride colorimetric preparation

Specifications / Requirementsss:

Ferric chloride (Nut. Div.)

Item: Ferric chloride (Merck /BDH) (Nut. Div.)

UNSPSC: Ferric chloride colorimetric preparation

Specifications / Requirementsss:

Ferric chloride (Merck /BDH) (Nut. Div.)

Item: Ferric citrate (Nut. Div.)

UNSPSC: Ferric chloride colorimetric preparation

Specifications / Requirementsss:

Ferric citrate (Nut. Div.)

Item: Florisil (Nut. Div.)

UNSPSC: Dried cut french florissa tulip

Specifications / Requirementsss:

Florisil (Nut. Div.)

Item: Flouride Test Kit (Nut. Div.)

UNSPSC: Blood bank test kits or supplies

Specifications / Requirementsss:

Flouride Test Kit (Nut. Div.)

Item: Fluoride Test Kit (Merck/ equivalent) (Nut. Div.)

UNSPSC: Androgeny and fertility test kits and supplies

Specifications / Requirementsss:

Fluoride Test Kit (Merck/ equivalent) (Nut. Div.)

Item: Formaldehyde (Nut. Div.)

UNSPSC: Aluminum chlorohydrex/formaldehyde/menthol/zinc undecylenate

Specifications / Requirementsss:

Formaldehyde (Nut. Div.)

Item: Foroglucinol (Merck /BDH) (Nut. Div.)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Foroglucinol (Merck /BDH) (Nut. Div.)

Item: Glucose (Merck /BDH) (Nut. Div.)

UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate

Specifications / Requirementsss:

Glucose (Merck /BDH) (Nut. Div.)

Item: Glycerin (AR grade) Scharlau/ equivalent (Nut. Div.)

UNSPSC: Acetic acid/antipyrine/benzocaine/glycerin

Specifications / Requirementsss:

Glycerin (AR grade) Scharlau/ equivalent (Nut. Div.)

Item: Hydrochloric Acid (Merck /Eq.) (Nut. Div.)

UNSPSC: Hydrochloric acid

Specifications / Requirementsss:

Hydrochloric Acid (Merck /Eq.) (Nut. Div.)

Item: Hydrochloric Acid (conc) (AR grade) (Merck /BDH/ equivalent) (Nut. Div.)

UNSPSC: Hydrochloric acid

Specifications / Requirementsss:

Hydrochloric Acid (conc) (AR grade) (Merck /BDH/ equivalent) (Nut. Div.)

Item: Hydrogen peroxide (Nut. Div.)

UNSPSC: Carbamide peroxide or hydrogen peroxide

Specifications / Requirementsss:

Hydrogen peroxide (Nut. Div.)

Item: Hydrogen peroxide (AR grade) Scharlau/ equivalent (Nut. Div.)

UNSPSC: Carbamide peroxide or hydrogen peroxide

Specifications / Requirementsss:

Hydrogen peroxide (AR grade) Scharlau/ equivalent (Nut. Div.)

Item: Iodine crystals (Merck /BDH) (Nut. Div.)

UNSPSC: Calcium/iodine

Specifications / Requirementsss:

Iodine crystals (Merck /BDH) (Nut. Div.)

Item: Iodine HANNA Instrument (Nut. Div.)

UNSPSC: Calcium/iodine

Specifications / Requirementsss:

Iodine HANNA Instrument (Nut. Div.)

Item: Iron HR HANNA Instrument (Nut. Div.)

UNSPSC: Iron Fe

Specifications / Requirementsss:

Iron HR HANNA Instrument (Nut. Div.)

Item: Kaliumdichromate (Nut. Div.)

UNSPSC: Chromate standards

Specifications / Requirementsss:

Kaliumdichromate (Nut. Div.)

Item: Kaliumjodid reinst (Nut. Div.)

UNSPSC: Acid or alkali resistant castable

Specifications / Requirementsss:

Kaliumjodid reinst (Nut. Div.)

Item: Lead chromate (Merck /BDH) (Nut. Div.)

UNSPSC: Chromate standards

Specifications / Requirementsss:

Lead chromate (Merck /BDH) (Nut. Div.)

Item: Magnesium HANNA Instrument (Nut. Div.)

UNSPSC: Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr

Specifications / Requirementsss:

Magnesium HANNA Instrument (Nut. Div.)

Item: Magnesium Sulfate (Merck/BDH) (Nut. Div.)

UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose

Specifications / Requirementsss:

Magnesium Sulfate (Merck/BDH) (Nut. Div.)

Item: Magnesium Sulfate Ar Grade (Merck /BDH) / (Nut. Div.) equivalent

UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose

Specifications / Requirementsss:

Magnesium Sulfate Ar Grade (Merck /BDH) / (Nut. Div.) equivalent

Item: Magnesium sulfate hepta hydrate (Merck /BDH) (Nut. Div.)

UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose

Specifications / Requirementsss:

Magnesium sulfate hepta hydrate (Merck /BDH) (Nut. Div.)

Item: Magnesium system reagent Thermoscientific (Nut. Div.)

UNSPSC: Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr

Specifications / Requirementsss:

Magnesium system reagent Thermoscientific (Nut. Div.)

Item: Magnesium Test Kit (Merck/Equivalent) (Nut. Div.)

UNSPSC: Acetaminophen/aluminum hydroxide/aspirin/caffeine/magnesium hydr

Specifications / Requirementsss:

Magnesium Test Kit (Merck/Equivalent) (Nut. Div.)

Item: Manganese HR HANNA Instrument (Nut. Div.)

UNSPSC: Chromic chloride/cupric chloride/manganese chloride/selenium/zinc chloride

Specifications / Requirementsss:

Manganese HR HANNA Instrument (Nut. Div.)

Item: Megnisumnitrat (Nut. Div.)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Megnisumnitrat (Nut. Div.)

Item: Methanol (HPLC grade) (Nut. Div.)

UNSPSC: Methanol

Specifications / Requirementsss:

Methanol (HPLC grade) (Nut. Div.)

Item: Methyl orange indicator (Nut. Div.)

UNSPSC: 3-methylmorphine or codeine

Specifications / Requirementsss:

Methyl orange indicator (Nut. Div.)

Item: Methyl red (Nut. Div.)

UNSPSC: 3-methylmorphine or codeine

Specifications / Requirementsss:

Methyl red (Nut. Div.)

Item: Methyl Red ( AR grade) (Merck /BDH) (Nut. Div.)

UNSPSC: 3-methylmorphine or codeine

Specifications / Requirementsss:

Methyl Red ( AR grade) (Merck /BDH) (Nut. Div.)

Item: Methylene blue (Nut. Div.)

UNSPSC: 3,4-methylenedioxyphenyl-2-propanone

Specifications / Requirementsss:

Methylene blue (Nut. Div.)

Item: Methylene blue (Merck /BDH) (AR grade) (Nut. Div.)

UNSPSC: 3,4-methylenedioxyphenyl-2-propanone

Specifications / Requirementsss:

Methylene blue (Merck /BDH) (AR grade) (Nut. Div.)

Item: Natrium hydrogen carbonates (Nut. Div.)

UNSPSC: 6-phosphogluconate dehydrogenase test system

Specifications / Requirementsss:

Natrium hydrogen carbonates (Nut. Div.)

Item: Natrium oxalate (Nut. Div.)

UNSPSC: B-type natriuretic peptide test system

Specifications / Requirementsss:

Natrium oxalate (Nut. Div.)

Item: n-hexane (HPLC grade) (Nut. Div.)

UNSPSC: Nandrolone cyclohexanecarboxylate

Specifications / Requirementsss:

n-hexane (HPLC grade) (Nut. Div.)

Item: Nickel HR HANNA Instrument (Nut. Div.)

UNSPSC: Cast coated anisotropic ferrous aluminum nickel cobalt magnet

Specifications / Requirementsss:

Nickel HR HANNA Instrument (Nut. Div.)

Item: Nitrate HANNA Instrument (Nut. Div.)

UNSPSC: Aminoethyl nitrate

Specifications / Requirementsss:

Nitrate HANNA Instrument (Nut. Div.)

Item: Nitrate kit thermoscientific (Nut. Div.)

UNSPSC: Aminoethyl nitrate

Specifications / Requirementsss:

Nitrate kit thermoscientific (Nut. Div.)

Item: Nitric Acid (AR grade) (Nut. Div.)

UNSPSC: The diagnosis of toxic effect of nitroglycerin and nitric acids and esters

Specifications / Requirementsss:

Nitric Acid (AR grade) (Nut. Div.)

Item: Nitrite HR HANNA Instrument (Nut. Div.)

UNSPSC: Amyl nitrite/sodium nitrite/sodium thiosulfate

Specifications / Requirementsss:

Nitrite HR HANNA Instrument (Nut. Div.)

Item: Nitrium chloride (Nut. Div.)

UNSPSC: Calcium/chloride/gluconate/magnesium/potassium/sodium/sulfate

Specifications / Requirementsss:

Nitrium chloride (Nut. Div.)

Item: Ozone HANNA Instrument (Nut. Div.)

UNSPSC: Ozone analyzers

Specifications / Requirementsss:

Ozone HANNA Instrument (Nut. Div.)

Item: Pepsin (Nut. Div.)

UNSPSC: Amylase/bile salts/dehydrocholic acid/lipase/pepsin/proteolytic

Specifications / Requirementsss:

Pepsin (Nut. Div.)

Item: Petroleum ether (40-60 oC) (AR grade) (Nut. Div.)

UNSPSC: Petroleum or chemical trucking service

Specifications / Requirementsss:

Petroleum ether (40-60 oC) (AR grade) (Nut. Div.)

Item: pH Buffer Tablet (10.00 + 0.02) BDH / equivalent (Nut. Div.)

UNSPSC: Buffer solutions

Specifications / Requirementsss:

pH Buffer Tablet (10.00 + 0.02) BDH / equivalent (Nut. Div.)

Item: PH buffer tablet (4.0+0.02) BDH / equivalent (Nut. Div.)

UNSPSC: Buffer solutions

Specifications / Requirementsss:

PH buffer tablet (4.0+0.02) BDH / equivalent (Nut. Div.)

Item: pH Buffer Tablet (7.00 + 0.02) BDH / equivalent (Nut. Div.)

UNSPSC: Buffer solutions

Specifications / Requirementsss:

pH Buffer Tablet (7.00 + 0.02) BDH / equivalent (Nut. Div.)

Item: Phenolphthalein indicator (Nut. Div.)

UNSPSC: Bisacodyl/magnesium citrate/phenolphthalein

Specifications / Requirementsss:

Phenolphthalein indicator (Nut. Div.)

Item: Phenolphthalein indicator (Merck /BDH) (Nut. Div.)

UNSPSC: Bisacodyl/magnesium citrate/phenolphthalein

Specifications / Requirementsss:

Phenolphthalein indicator (Merck /BDH) (Nut. Div.)

Item: Pholoroglucinol (Merck /BDH) (Nut. Div.)

UNSPSC: Diagnosis of isolated proteinuria with specified morphological lesion, dense deposit disease

Specifications / Requirementsss:

Pholoroglucinol (Merck /BDH) (Nut. Div.)

Item: Phosphate HR HANNA Instrument (Nut. Div.)

UNSPSC: Acid phosphatase

Specifications / Requirementsss:

Phosphate HR HANNA Instrument (Nut. Div.)

Item: Phosphomolybdic Acid (Merck /BDH) (Nut. Div.)

UNSPSC: 2,3-diphosphoglyceric acid test system

Specifications / Requirementsss:

Phosphomolybdic Acid (Merck /BDH) (Nut. Div.)

Item: Phosphorus penta Oxide (AR grade) Scharlau/ equivalent (Nut. Div.)

UNSPSC: Diagnosis of disorders of phosphorus metabolism and phosphatases

Specifications / Requirementsss:

Phosphorus penta Oxide (AR grade) Scharlau/ equivalent (Nut. Div.)

Item: Ploroglucinol (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)

UNSPSC: Exploration or development system spare parts or accessories

Specifications / Requirementsss:

Ploroglucinol (AR grade) (Merck / BDH/ Equivalent) (Nut. Div.)

Item: Potassium Chloride AR grade (Merck/ BDH) / equivalent (Nut. Div.)

UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate

Specifications / Requirementsss:

Potassium Chloride AR grade (Merck/ BDH) / equivalent (Nut. Div.)

Item: Potassium Chloride (Merck/ BDH) (Nut. Div.)

UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate

Specifications / Requirementsss:

Potassium Chloride (Merck/ BDH) (Nut. Div.)

Item: Potassium Chromate AR Grade (Merck /BDH) / equivalent (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Potassium Chromate AR Grade (Merck /BDH) / equivalent (Nut. Div.)

Item: Potassium dichromate (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Potassium dichromate (Nut. Div.)

Item: Potassium ferricyanide (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Potassium ferricyanide (Nut. Div.)

Item: Potassium ferricyanide (Merck /BDH) (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Potassium ferricyanide (Merck /BDH) (Nut. Div.)

Item: Potassium HANNA Instrument (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Potassium HANNA Instrument (Nut. Div.)

Item: Potassium hydrogen phthalate (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Potassium hydrogen phthalate (Nut. Div.)

Item: Potassium Hydroxide (AR grade) Scharlau/ equivalent (Nut. Div.)

UNSPSC: Potassium hydroxide

Specifications / Requirementsss:

Potassium Hydroxide (AR grade) Scharlau/ equivalent (Nut. Div.)

Item: Potassium Iodide (Scharlau) (Nut. Div.)

UNSPSC: Aminophylline/ephedrine/phenobarbital/potassium iodide

Specifications / Requirementsss:

Potassium Iodide (Scharlau) (Nut. Div.)

Item: Potassium sodium tartrate (Nut. Div.)

UNSPSC: Potassium sodium tartrate

Specifications / Requirementsss:

Potassium sodium tartrate (Nut. Div.)

Item: Resorcinol (Nut. Div.)

UNSPSC: Acetone/basic fuchsin/boric acid/resorcinol

Specifications / Requirementsss:

Resorcinol (Nut. Div.)

Item: Resorcinol (Merck /BDH) (Nut. Div.)

UNSPSC: Acetone/basic fuchsin/boric acid/resorcinol

Specifications / Requirementsss:

Resorcinol (Merck /BDH) (Nut. Div.)

Item: Salicylasure gefallt (Nut. Div.)

UNSPSC: Aceclidine salicylate

Specifications / Requirementsss:

Salicylasure gefallt (Nut. Div.)

Item: Silica gel (Nut. Div.)

UNSPSC: Silica gel

Specifications / Requirementsss:

Silica gel (Nut. Div.)

Item: Silver nitrate AR Grade (Merck/ equivalent) (Nut. Div.)

UNSPSC: Silver nitrate

Specifications / Requirementsss:

Silver nitrate AR Grade (Merck/ equivalent) (Nut. Div.)

Item: Sodium acetate (Merck /BDH) (Nut. Div.)

UNSPSC: Sodium acetate

Specifications / Requirementsss:

Sodium acetate (Merck /BDH) (Nut. Div.)

Item: Sodium benzoate (Nut. Div.)

UNSPSC: Caffeine/sodium benzoate

Specifications / Requirementsss:

Sodium benzoate (Nut. Div.)

Item: Sodium bicarbonate (Merck /Equivalent) (Nut. Div.)

UNSPSC: Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate

Specifications / Requirementsss:

Sodium bicarbonate (Merck /Equivalent) (Nut. Div.)

Item: Sodium bisulfate (Merck /BDH) (Nut. Div.)

UNSPSC: Alginic acid/aluminum hydroxide/magnesium trisilicate/sodium bicarbonate

Specifications / Requirementsss:

Sodium bisulfate (Merck /BDH) (Nut. Div.)

Item: Sodium carbonate (Merck /BDH)

UNSPSC: Boric acid/potassium chloride/sodium carbonate

Specifications / Requirementsss:

Sodium carbonate (Merck /BDH)

Item: Sodium Chloride (AR grade) Scharlau/ equivalent (Nut. Div.)

UNSPSC: Aminophylline/sodium chloride

Specifications / Requirementsss:

Sodium Chloride (AR grade) Scharlau/ equivalent (Nut. Div.)

Item: Sodium chromate (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Sodium chromate (Nut. Div.)

Item: Sodium hydroxide (Merck /BDH) (Nut. Div.)

UNSPSC: Sodium hydroxide

Specifications / Requirementsss:

Sodium hydroxide (Merck /BDH) (Nut. Div.)

Item: Sodium sulphate (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Sodium sulphate (Nut. Div.)

Item: Sodium thiosulphate (Merck /BDH) (Nut. Div.)

UNSPSC: Amyl nitrite/sodium nitrite/sodium thiosulfate

Specifications / Requirementsss:

Sodium thiosulphate (Merck /BDH) (Nut. Div.)

Item: Sodium tungtate (Merck /BDH) (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Sodium tungtate (Merck /BDH) (Nut. Div.)

Item: SPADNS, sodium 2-(parasulfophenylazo)-1,8-dihydroxy-3,6-naphthalene disulfonate, also called 4,5-dihydroxy-3-(parasulfophenylazo)-2,7 naphthalenedisulfonic acid trisodium salt (Nut. Div.)

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

SPADNS, sodium 2-(parasulfophenylazo)-1,8-dihydroxy-3,6-naphthalene disulfonate, also called 4,5-dihydroxy-3-(parasulfophenylazo)-2,7 naphthalenedisulfonic acid trisodium salt (Nut. Div.)

Item: Standard/Calibrator each of Na, K, Ca (1000 ppm or 500 ppm) (Nut. Div.)

UNSPSC: Androgeny and fertility quality controls and calibrators and standards

Specifications / Requirementsss:

Standard/Calibrator each of Na, K, Ca (1000 ppm or 500 ppm) (Nut. Div.)

Item: Starch soluble (AR grade) (Nut. Div.)

UNSPSC: Benzethonium chloride/corn starch/kaolin/zinc oxide

Specifications / Requirementsss:

Starch soluble (AR grade) (Nut. Div.)

Item: Sucrose (Nut. Div.)

UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose

Specifications / Requirementsss:

Sucrose (Nut. Div.)

Item: Sucrose (Merck /BDH) (Nut. Div.)

UNSPSC: Bisacodyl/magnesium citrate/magnesium sulfate/senna/sucrose

Specifications / Requirementsss:

Sucrose (Merck /BDH) (Nut. Div.)

Item: Sulfate HANNA Instrument (Nut. Div.)

UNSPSC: Alcohol/sulfur/zinc oxide/zinc sulfate

Specifications / Requirementsss:

Sulfate HANNA Instrument (Nut. Div.)

Item: Sulphate kit thermoscientific (Nut. Div.)

UNSPSC: Sodium thiosulfate or thiosulfate or thiosulphate

Specifications / Requirementsss:

Sulphate kit thermoscientific (Nut. Div.)

Item: Sulphuric Acid (conc) (AR grade) (Merck / BDH). (Nut. Div.)

UNSPSC: Sulphuric acid

Specifications / Requirementsss:

Sulphuric Acid (conc) (AR grade) (Merck / BDH). (Nut. Div.)

Item: Total Chlorine HANNA Instrument (Nut. Div.)

UNSPSC: Chlorine Cl

Specifications / Requirementsss:

Total Chlorine HANNA Instrument (Nut. Div.)

Item: Tri chloro acetic acid (Nut. Div.)

UNSPSC: Acetic acid/benzalkonuim chloride/chloroxylenol/glycerin

Specifications / Requirementsss:

Tri chloro acetic acid (Nut. Div.)

Item: Trifluoro Acetic Acid (AR grade) (Nut. Div.)

UNSPSC: 5-hydroxyindole acetic acid/serotonin test system

Specifications / Requirementsss:

Trifluoro Acetic Acid (AR grade) (Nut. Div.)

Item: Urea (Merck /BDH) (Nut. Div.)

UNSPSC: Urea UF

Specifications / Requirementsss:

Urea (Merck /BDH) (Nut. Div.)

Item: Zinc acetate (Merck /BDH) (Nut. Div.)

UNSPSC: Diphenhydramine/zinc acetate

Specifications / Requirementsss:

Zinc acetate (Merck /BDH) (Nut. Div.)

Item: Zinc HANNA Instrument (Nut. Div.)

UNSPSC: Alcohol/benzoic acid/boric acid/zinc oxide/zinc stearate

Specifications / Requirementsss:

Zinc HANNA Instrument (Nut. Div.)

Item: MacConkey agar purple CV (oxide eq) (Nut. Div.)

UNSPSC: Chemical or pharmaceutical machinery or equipment manufacture services

Specifications / Requirementsss:

MacConkey agar purple CV (oxide eq) (Nut. Div.)

Item: Plate count agar (Nut. Div.)

UNSPSC: Polymerase chain reaction PCR tube strip and plate cooler

Specifications / Requirementsss:

Plate count agar (Nut. Div.)

Item: Bismuth sulphite agar (Nut. Div.)

UNSPSC: Benzocaine/bismuth subgallate/phenylmecuric nitrate/zinc oxide

Specifications / Requirementsss:

Bismuth sulphite agar (Nut. Div.)

Item: XLD agar (Nut. Div.)

UNSPSC: Agar-agar

Specifications / Requirementsss:

XLD agar (Nut. Div.)

Item: Sabouraud Dextrose agar (Nut. Div.)

UNSPSC: Anticoagulant citrate phosphate dextrose solution

Specifications / Requirementsss:

Sabouraud Dextrose agar (Nut. Div.)

Item: Simmons citrate agar (Nut. Div.)

UNSPSC: Anhydrous glucose/potassium chloride/sodium chloride/trisodium citrate

Specifications / Requirementsss:

Simmons citrate agar (Nut. Div.)

Item: Mannitol salt agar (Nut. Div.)

UNSPSC: Amifostine/mannitol

Specifications / Requirementsss:

Mannitol salt agar (Nut. Div.)

Item: Nutrient agar (Nut. Div.)

UNSPSC: Nutrients

Specifications / Requirementsss:

Nutrient agar (Nut. Div.)

Item: Tryptone soya agar (Nut. Div.)

UNSPSC: Tryptophan

Specifications / Requirementsss:

Tryptone soya agar (Nut. Div.)

Item: Motility agar (Nut. Div.)

UNSPSC: Measurement of gastrointestinal motility, via natural or artificial opening

Specifications / Requirementsss:

Motility agar (Nut. Div.)

Item: EMB agar (Nut. Div.)

UNSPSC: Agar-agar

Specifications / Requirementsss:

EMB agar (Nut. Div.)

Item: TCBS agar (Nut. Div.)

UNSPSC: Agar-agar

Specifications / Requirementsss:

TCBS agar (Nut. Div.)

Item: Peptone water (Nut. Div.)

UNSPSC: Water

Specifications / Requirementsss:

Peptone water (Nut. Div.)

Item: MacConkey broth purple CV-3 (Nut. Div.)

UNSPSC: Mine action center MAC or mine action coordination center MACC service

Specifications / Requirementsss:

MacConkey broth purple CV-3 (Nut. Div.)

Item: BGLB 20% (Nut. Div.)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

BGLB 20% (Nut. Div.)

Item: MR-VP broth (Nut. Div.)

UNSPSC: Bottled broth media for bacteria

Specifications / Requirementsss:

MR-VP broth (Nut. Div.)

Item: Hydrogen peroxide 30% (Nut. Div.)

UNSPSC: Carbamide peroxide or hydrogen peroxide

Specifications / Requirementsss:

Hydrogen peroxide 30% (Nut. Div.)

Item: Kovac's reagent (Nut. Div.)

UNSPSC: Acid, alcohol, and decolorizing fluid reagents

Specifications / Requirementsss:

Kovac's reagent (Nut. Div.)

Item: Oxidase reagent (Nut. Div.)

UNSPSC: Diagnosis of defects of catalase and peroxidase

Specifications / Requirementsss:

Oxidase reagent (Nut. Div.)

Item: Emulsion oil (Nut. Div.)

UNSPSC: Emulsions

Specifications / Requirementsss:

Emulsion oil (Nut. Div.)

Item: Barritt reagent-A (Nut. Div.)

UNSPSC: Acetic acid, alcohol, and toluidine blue combination reagents

Specifications / Requirementsss:

Barritt reagent-A (Nut. Div.)

Item: Barritt reagent-B (Nut. Div.)

UNSPSC: Acetic acid, alcohol, and toluidine blue combination reagents

Specifications / Requirementsss:

Barritt reagent-B (Nut. Div.)

Item: Methylated Spirit (Nut. Div.)

UNSPSC: Camphor/eucalyptus oil/menthol/turpentine spirits

Specifications / Requirementsss:

Methylated Spirit (Nut. Div.)

Item: Catalase test (Sigma Aldrich) (CMLT)

UNSPSC: Diagnosis of defects of catalase and peroxidase

Specifications / Requirementsss:

Catalase test (Sigma Aldrich) (CMLT)

Item: Oxidase test (Biomerieux) (CMLT)

UNSPSC: Leukocyte peroxidase test

Specifications / Requirementsss:

Oxidase test (Biomerieux) (CMLT)

Item: Ziehl Neelsen (Diacheme) (CMLT)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Ziehl Neelsen (Diacheme) (CMLT)

Item: Field Stain set(Diacheme) (CMLT)

UNSPSC: Field strength measuring equipment

Specifications / Requirementsss:

Field Stain set(Diacheme) (CMLT)

Item: Spirit Lamp (CMLT)

UNSPSC: Camphor/eucalyptus oil/menthol/turpentine spirits

Specifications / Requirementsss:

Spirit Lamp (CMLT)

Item: Disposable gloves (Nylon) (CMLT)

UNSPSC: Chemical resistant gloves

Specifications / Requirementsss:

Disposable gloves (Nylon) (CMLT)

Item: HCV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HCV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HBs Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HBs Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HBs Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HBs Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HBe Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HBe Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HBe Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HBe Ag (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)

Item: HBc IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6-12 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HBc IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6-12 months CE-IVD/FDA approved 96 test (PHLD)

Item: HB core IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HB core IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HAV Ab IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HAV Ab IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HEV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

HEV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Toxoplasma IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Basic Diagnostic Procedures

Specifications / Requirementsss:

Toxoplasma IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Toxoplasma IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6-12 months\ CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnosis of toxoplasma hepatitis

Specifications / Requirementsss:

Toxoplasma IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6-12 months\ CE-IVD/FDA approved 96 test (PHLD)

Item: Rubella IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnoses of rubella without complication

Specifications / Requirementsss:

Rubella IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Rubella IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnoses of rubella without complication

Specifications / Requirementsss:

Rubella IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: CMV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

CMV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test. (PHLD)

Item: CMV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

CMV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HSV IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

HSV IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved (PHLD)

Item: HSV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

HSV IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Measles IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnoses of measles complicated by encephalitis

Specifications / Requirementsss:

Measles IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Measles IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnoses of measles complicated by encephalitis

Specifications / Requirementsss:

Measles IgM (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Mumps IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnoses of mumps pancreatitis

Specifications / Requirementsss:

Mumps IgG (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Mumps IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnoses of mumps pancreatitis

Specifications / Requirementsss:

Mumps IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: VZV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

VZV IgG (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: VZV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

VZV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: EBV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

EBV IgM (Qualitative) Manual ELISAwith positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: HIV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

HIV Ab (Qualitative) Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Rabies Ab titer, Biorad/equivalent Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

UNSPSC: Diagnosis of sylvatic rabies

Specifications / Requirementsss:

Rabies Ab titer, Biorad/equivalent Manual ELISA with positive and negative controls Shelf life minimum 6 months CE-IVD/FDA approved 96 test (PHLD)

Item: Dengue Virus IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)

UNSPSC: Diagnosis of dengue haemorrhagic fever

Specifications / Requirementsss:

Dengue Virus IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)

Item: Dengue Virus IgG ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)

UNSPSC: Diagnosis of dengue haemorrhagic fever

Specifications / Requirementsss:

Dengue Virus IgG ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved Detection of suspected target organism should be in one well 96 test (PHLD)

Item: Dengue Virus NS1 ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved. Detection of suspected target organism should be in one well 96 test

UNSPSC: Diagnoses of dengue fever or classical dengue

Specifications / Requirementsss:

Dengue Virus NS1 ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved. Detection of suspected target organism should be in one well 96 test

Item: Dengue Virus IgG/IgM and NS1, Combo Rapid Test Kit(Qualitative) Should include all reagents Shelf life 6-12 months CE-IVD/FDA approved 25 test (PHLD)

UNSPSC: Diagnoses of dengue fever or classical dengue

Specifications / Requirementsss:

Dengue Virus IgG/IgM and NS1, Combo Rapid Test Kit(Qualitative) Should include all reagents Shelf life 6-12 months CE-IVD/FDA approved 25 test (PHLD)

Item: West Nile Fever Virus IgM ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)

UNSPSC: Diagnosis of west nile virus infection

Specifications / Requirementsss:

West Nile Fever Virus IgM ELISA Kit(Qualitative) Manual ELISA with all necessary reagents Shelf life 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)

Item: Japanese Encephalitis IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)

UNSPSC: Diagnoses of australian encephalitis

Specifications / Requirementsss:

Japanese Encephalitis IgM ELISA Kit (Qualitative) Manual ELISA with all necessary reagents Shelf life 12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test (PHLD)

Item: Mpox Virus Realtime-PCR Kit (Qualitative) positive and negative control, Must Detect both Clades (I &II) Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 48 test (PHLD)

UNSPSC: Diagnosis of acute bronchiolitis due to human metapneumovirus

Specifications / Requirementsss:

Mpox Virus Realtime-PCR Kit (Qualitative) positive and negative control, Must Detect both Clades (I &II) Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 48 test (PHLD)

Item: CCHFV Realtime-PCR Kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

CCHFV Realtime-PCR Kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

Item: Triplex Realtime-PCR kit for Dengue, Chikungunya & Zika Virus Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

UNSPSC: Triplex pumps

Specifications / Requirementsss:

Triplex Realtime-PCR kit for Dengue, Chikungunya & Zika Virus Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

Item: Oropouche Virus Real Time PCR kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA/RUO approved For Human Specimen 96 test (PHLD)

UNSPSC: Diagnoses of oropouche virus disease

Specifications / Requirementsss:

Oropouche Virus Real Time PCR kit (Qualitative) Positive and negative control. Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA/RUO approved For Human Specimen 96 test (PHLD)

Item: Filo Virus Realtime-PCR Kits (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

UNSPSC: Butofilolol

Specifications / Requirementsss:

Filo Virus Realtime-PCR Kits (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

Item: West Nile Fever Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

UNSPSC: Diagnosis of west nile virus infection

Specifications / Requirementsss:

West Nile Fever Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

Item: Varicella-Zoster Virus Realtime-PCR Kit (Qualitative) positive and negative control shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

UNSPSC: Diagnosis of disseminated zoster

Specifications / Requirementsss:

Varicella-Zoster Virus Realtime-PCR Kit (Qualitative) positive and negative control shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

Item: CMV Real Time PCR kit (Qualitative) positive and negative control: Shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test. (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

CMV Real Time PCR kit (Qualitative) positive and negative control: Shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen Detection of suspected target organism should be in one well 96 test. (PHLD)

Item: HSV Real Time Kit (Qualitative) Must Identify HSV-1 and HSV-2 in single reaction positive and negative control shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

UNSPSC: Oilfield real time well data monitoring services

Specifications / Requirementsss:

HSV Real Time Kit (Qualitative) Must Identify HSV-1 and HSV-2 in single reaction positive and negative control shelf life minimum 6-12 months CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

Item: Rabies Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

UNSPSC: Rabies vaccine

Specifications / Requirementsss:

Rabies Virus Realtime-PCR Kit (Qualitative) positive and negative control Shelf life minimum 6-12 months Detection of suspected target organism should be in one well CE-IVD/FDA approved For Human Specimen 96 test (PHLD)

Item: Realtime-PCR Kit of Hepatitis B Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included

UNSPSC: Oilfield real time well data monitoring services

Specifications / Requirementsss:

Realtime-PCR Kit of Hepatitis B Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved 96 test (PHLD)

Item: Realtime-PCR Kit of Hepatitis C Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved\ I

UNSPSC: Oilfield real time well data monitoring services

Specifications / Requirementsss:

Realtime-PCR Kit of Hepatitis C Virus ( Quantitative) Human plasma/serum , Sensitivity (LOD): ≤ 10–20 IU/mL Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved\ Internal Control: Included 96 test (PHLD)

Item: Trioplex Realtime -PCR Kit for SARS-CoV-2, Flu A & B, RSV, Target Pathogens: SARS-CoV-2, Influenza A (including H1N1 and H3N2), Influenza B, Respiratory Syncytial Virus (RSV A/B) Specimen Type: Nasopharyngeal swabs, oropharyngeal swabs Internal Cont

UNSPSC: Oilfield real time well data monitoring services

Specifications / Requirementsss:

Trioplex Realtime -PCR Kit for SARS-CoV-2, Flu A & B, RSV, Target Pathogens: SARS-CoV-2, Influenza A (including H1N1 and H3N2), Influenza B, Respiratory Syncytial Virus (RSV A/B) Specimen Type: Nasopharyngeal swabs, oropharyngeal swabs Internal Control: Included, Positive and Negative Controls included Compatible with major Real-Time PCR systems Shelf Life: Minimum 6–12 months CE-IVD / FDA approved 96 test (PHLD)

Item: Positive Control for Oropouche Virus Type: Inactivated virus / Plasmid control Form: Lyophilized Purpose: Use as a positive control in molecular diagnostic assays (e.g., real-time RT-PCR, conventional RT-PCR) for OROV Volume: Minimum 100µL per via

UNSPSC: Diagnoses of oropouche virus disease

Specifications / Requirementsss:

Positive Control for Oropouche Virus Type: Inactivated virus / Plasmid control Form: Lyophilized Purpose: Use as a positive control in molecular diagnostic assays (e.g., real-time RT-PCR, conventional RT-PCR) for OROV Volume: Minimum 100µL per vial 100 Ul (PHLD)

Item: MAYV_FNF, 5’-CACGGACMTTTTGCCTTCA 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

MAYV_FNF, 5’-CACGGACMTTTTGCCTTCA 50nm DeSalt (PHLD)

Item: MAYV_FNR, 5’-AGACTGCCACCTCTGCTKGAG 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

MAYV_FNR, 5’-AGACTGCCACCTCTGCTKGAG 50nm DeSalt (PHLD)

Item: MAYV_FNP, 5’-VIC-ACAGATCAGACATGCAGG-NFQ-MGB 200nm HPLC (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

MAYV_FNP, 5’-VIC-ACAGATCAGACATGCAGG-NFQ-MGB 200nm HPLC (PHLD)

Item: OROV_FNF,5’-TCCGGAGGCAGCATATGTG 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

OROV_FNF,5’-TCCGGAGGCAGCATATGTG 50nm DeSalt (PHLD)

Item: OROV_FNR, 5’-ACAACACCAGCATTGAGCACTT 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

OROV_FNR, 5’-ACAACACCAGCATTGAGCACTT 50nm DeSalt (PHLD)

Item: OROV_FNP, 5’-FAM-CATTTGAAGCTAGATACGG-NFQ-MGB 200nm HPLC (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

OROV_FNP, 5’-FAM-CATTTGAAGCTAGATACGG-NFQ-MGB 200nm HPLC (PHLD)

Item: NF5,TGAGTGCTCTCCAACTTCTGCAGT 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

NF5,TGAGTGCTCTCCAACTTCTGCAGT 50nm DeSalt (PHLD)

Item: NR5,TTCTTCAGAGCTTGCATCTTGAT 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

NR5,TTCTTCAGAGCTTGCATCTTGAT 50nm DeSalt (PHLD)

Item: PF1,TTTAATCGACATGGGAGCAATTG 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

PF1,TTTAATCGACATGGGAGCAATTG 50nm DeSalt (PHLD)

Item: PR1, TAAGGTGGGTCAGACGGAGAGA 50nm DeSalt (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

PR1, TAAGGTGGGTCAGACGGAGAGA 50nm DeSalt (PHLD)

Item: TaqMan MGB Probe, VIC-AGAATTCATCCTGGCAGCT-NFQ 200 nm HPLC (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

TaqMan MGB Probe, VIC-AGAATTCATCCTGGCAGCT-NFQ 200 nm HPLC (PHLD)

Item: RA Factor Latex 100 tests(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

RA Factor Latex 100 tests(PHLD)

Item: CRP Latex 100 tests(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

CRP Latex 100 tests(PHLD)

Item: Anti IgA Ab ( Manual Elisa )(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

Anti IgA Ab ( Manual Elisa )(PHLD)

Item: Anti CCP IgGAb ( Manual Elisa)(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

Anti CCP IgGAb ( Manual Elisa)(PHLD)

Item: ANA IgG kit Elisa (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

ANA IgG kit Elisa (PHLD)

Item: BrucellaAb Latex 100 tests(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

BrucellaAb Latex 100 tests(PHLD)

Item: ASO Titter Latex 100 tests(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

ASO Titter Latex 100 tests(PHLD)

Item: ICT MP Devices(PHLD)

UNSPSC: Altitude measuring devices

Specifications / Requirementsss:

ICT MP Devices(PHLD)

Item: Anti TTG IgG Elisa Manual(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

Anti TTG IgG Elisa Manual(PHLD)

Item: Anti DeaminatedgladinAb ( Elisa ) DGP IgG(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

Anti DeaminatedgladinAb ( Elisa ) DGP IgG(PHLD)

Item: H Pylori for stool Antigen Devices (PHLD)

UNSPSC: Diagnosis of adult hypertrophic pyloric stenosis

Specifications / Requirementsss:

H Pylori for stool Antigen Devices (PHLD)

Item: Total Immunoglobulin A Elisa kit(PHLD)

UNSPSC: Bacterial immunoglobulins

Specifications / Requirementsss:

Total Immunoglobulin A Elisa kit(PHLD)

Item: VDRL Latex kit 100 tests(PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

VDRL Latex kit 100 tests(PHLD)

Item: H Pylori IgM Antibodies Elisa kit 96 tests(PHLD)

UNSPSC: Diagnosis of adult hypertrophic pyloric stenosis

Specifications / Requirementsss:

H Pylori IgM Antibodies Elisa kit 96 tests(PHLD)

Item: Urine Pregnancy Kit (PHLD)

UNSPSC: The diagnosis of extravasation of urine

Specifications / Requirementsss:

Urine Pregnancy Kit (PHLD)

Item: Occult Blood Kit (PHLD)

UNSPSC: Occult blood test

Specifications / Requirementsss:

Occult Blood Kit (PHLD)

Item: Streptococcus grouping kit (Thermo) (PHLD)

UNSPSC: Diagnosis of acute bronchitis due to streptococcus

Specifications / Requirementsss:

Streptococcus grouping kit (Thermo) (PHLD)

Item: G6PD Test Kit (Qualitative Method) (Span Diagnostics, France) (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

G6PD Test Kit (Qualitative Method) (Span Diagnostics, France) (PHLD)

Item: ABO Blood Grouping Kit, (Atlas Medical, Germany) (03x10ml/kit) (PHLD)

UNSPSC: Kits or enzymes for sequencing

Specifications / Requirementsss:

ABO Blood Grouping Kit, (Atlas Medical, Germany) (03x10ml/kit) (PHLD)

Item: Absolute ethanol, molecular biology grade (2.5 liter Pack) (PHLD)

UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid

Specifications / Requirementsss:

Absolute ethanol, molecular biology grade (2.5 liter Pack) (PHLD)

Item: Sodium hypochlorite Solution) 100% (PHLD)

UNSPSC: Benzalkonium chloride/edetate/sodium hydroxide

Specifications / Requirementsss:

Sodium hypochlorite Solution) 100% (PHLD)

Item: Medium RPMI 1640 (!X) Without L-Glutamine Ref No 21870-076, Lot No. 2518007 Gibco company 500 ml (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Medium RPMI 1640 (!X) Without L-Glutamine Ref No 21870-076, Lot No. 2518007 Gibco company 500 ml (PHLD)

Item: Phytohaemagglutinin (PHA)- CAT No. 151884-MP Biomedicals, LLC (Pack of 10mg)(PHLD)

UNSPSC: Phytotron

Specifications / Requirementsss:

Phytohaemagglutinin (PHA)- CAT No. 151884-MP Biomedicals, LLC (Pack of 10mg)(PHLD)

Item: Fetal Bovine Serum (FBS) (Pack of 100 ml) (PHLD)

UNSPSC: Bovine semen

Specifications / Requirementsss:

Fetal Bovine Serum (FBS) (Pack of 100 ml) (PHLD)

Item: Penicillin Streptomycin (PSS) ICN/ Sigma /Equivalent (Pack of 100 ml) (PHLD)

UNSPSC: Adicillin or penicillin n

Specifications / Requirementsss:

Penicillin Streptomycin (PSS) ICN/ Sigma /Equivalent (Pack of 100 ml) (PHLD)

Item: L-Glutamine (ICN, Cat No. 16-801049) (Pack of 100 ml) (PHLD)

UNSPSC: Glutamine

Specifications / Requirementsss:

L-Glutamine (ICN, Cat No. 16-801049) (Pack of 100 ml) (PHLD)

Item: Ethanol (Merck/BDH/Equal) (Pack of 2.5 lit)

UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid

Specifications / Requirementsss:

Ethanol (Merck/BDH/Equal) (Pack of 2.5 lit)

Item: Methanol (Merck/BDH/Equal) (Pack of 2.5 lit) (PHLD)

UNSPSC: Methanol

Specifications / Requirementsss:

Methanol (Merck/BDH/Equal) (Pack of 2.5 lit) (PHLD)

Item: Glycerin (Pack of 2.5 lit)(PHLD)

UNSPSC: Acetic acid/antipyrine/benzocaine/glycerin

Specifications / Requirementsss:

Glycerin (Pack of 2.5 lit)(PHLD)

Item: Acetic Acid Ct No 40766363-Merk (Pack of 2.5 lit) (PHLD)

UNSPSC: Acetic acid

Specifications / Requirementsss:

Acetic Acid Ct No 40766363-Merk (Pack of 2.5 lit) (PHLD)

Item: Nuclease free water Invitrogen Ultra Pure Distilled Water Dnase/RNase free (500ml) (PHLD)

UNSPSC: Chloramphenicol/desoxyribonuclease/fibrinolysin

Specifications / Requirementsss:

Nuclease free water Invitrogen Ultra Pure Distilled Water Dnase/RNase free (500ml) (PHLD)

Item: Absolute Ethanol (2.5L) (PHLD)

UNSPSC: Benzocaine/chlorobutanol/ethanol/menthol/tannic acid

Specifications / Requirementsss:

Absolute Ethanol (2.5L) (PHLD)

Item: PCR Tubes with strips (0.2ml) thin walled PCR Tubes strip with indidual flat cap Dnase,RNase and pyrogen free 120 strip/Pack NEST Biotechnology (PHLD)

UNSPSC: Polymerase chain reaction PCR tube strip and plate cooler

Specifications / Requirementsss:

PCR Tubes with strips (0.2ml) thin walled PCR Tubes strip with indidual flat cap Dnase,RNase and pyrogen free 120 strip/Pack NEST Biotechnology (PHLD)

Item: Anaerobic gas pack( pack of 10) (PHLD)

UNSPSC: Anaerobic jars or accessories

Specifications / Requirementsss:

Anaerobic gas pack( pack of 10) (PHLD)

Item: Potassium hydroxide (PHLD)

UNSPSC: Potassium hydroxide

Specifications / Requirementsss:

Potassium hydroxide (PHLD)

Item: Potassium Tellurite`

UNSPSC: Acetate/calcium/chloride/gluconate/magnesium/potassium/sodium

Specifications / Requirementsss:

Potassium Tellurite`

Item: (HCL) concentrated (PHLD)

UNSPSC: Bisacodyl/docusate/senna concentrate/senna extract/sucrose

Specifications / Requirementsss:

(HCL) concentrated (PHLD)

Item: Hydrogen Peroxide (PHLD)

UNSPSC: Carbamide peroxide or hydrogen peroxide

Specifications / Requirementsss:

Hydrogen Peroxide (PHLD)

Item: Glycerin (Glycerol) 87%, Merck (Pack of 2.5) (PHLD)

UNSPSC: Acetic acid/antipyrine/benzocaine/glycerin

Specifications / Requirementsss:

Glycerin (Glycerol) 87%, Merck (Pack of 2.5) (PHLD)

Item: Hand Disinfectant/ Antiseptic (PHLD)

UNSPSC: Dialysate delivery system disinfectants

Specifications / Requirementsss:

Hand Disinfectant/ Antiseptic (PHLD)

Item: Hypochlorite (KOSDAQ ) 6-14% (PHLD)

UNSPSC: Sodium hypochlorite

Specifications / Requirementsss:

Hypochlorite (KOSDAQ ) 6-14% (PHLD)

Item: Culti Loops Thermofisher or equivalent ATCC 49226 Neisseria gonorrhoeae (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Culti Loops Thermofisher or equivalent ATCC 49226 Neisseria gonorrhoeae (PHLD)

Item: Culti Loops Thermofisher or equivalent ATCC 43300 S. aureus methicillin resistant control (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Culti Loops Thermofisher or equivalent ATCC 43300 S. aureus methicillin resistant control (PHLD)

Item: Culti Loops Thermofisher or equivalent ATCC 27853Peudomonasaeruginosa (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Culti Loops Thermofisher or equivalent ATCC 27853Peudomonasaeruginosa (PHLD)

Item: Culti Loops Thermofisher or equivalent ATCC 25922 E.coli (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Culti Loops Thermofisher or equivalent ATCC 25922 E.coli (PHLD)

Item: Culti Loops Thermofisher or equivalent ATCC 19615 S.pyogenes (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Culti Loops Thermofisher or equivalent ATCC 19615 S.pyogenes (PHLD)

Item: Culti Loops Thermofisher or equivalent ATCC 27012 C. diphtheria (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Culti Loops Thermofisher or equivalent ATCC 27012 C. diphtheria (PHLD)

Item: Culti Loops Thermofisher or equivalent ATCC 27010 C. diphtheria (PHLD)

UNSPSC: Industrial chemical equipment spare parts and accessories

Specifications / Requirementsss:

Culti Loops Thermofisher or equivalent ATCC 27010 C. diphtheria (PHLD)

Item: Bovine Albumin 22 %(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)

UNSPSC: Bovine production services

Specifications / Requirementsss:

Bovine Albumin 22 %(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)

Item: Anti-Human Globulin(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)

UNSPSC: Alpha-2-macroglobulin immunological test system

Specifications / Requirementsss:

Anti-Human Globulin(Atlas Medical, Germany) ( Pack of 10ml) (PHLD)

Item: Hand Sanitizer (liquid)(OROSEPT Solution) ( Pack of 500ml) (PHLD)

UNSPSC: Hand sanitizer

Specifications / Requirementsss:

Hand Sanitizer (liquid)(OROSEPT Solution) ( Pack of 500ml) (PHLD)

Item: Immersion Oil for Microscopy, (Sigma-Aldrich Co., USA) ( Pack of500ml) (PHLD)

UNSPSC: Microscope immersion oil

Specifications / Requirementsss:

Immersion Oil for Microscopy, (Sigma-Aldrich Co., USA) ( Pack of500ml) (PHLD)

Item: Reticulocyte Count Stain ( Pack of 100 ml) (Diachem ) (PHLD)

UNSPSC: Diagnosis of actinic reticuloid

Specifications / Requirementsss:

Reticulocyte Count Stain ( Pack of 100 ml) (Diachem ) (PHLD)

Item: Giemsa Stain (Pack of 1000ml) (Merck, KGaA, Germany) (PHLD)

UNSPSC: Alloy steel/stainless steel check valve

Specifications / Requirementsss:

Giemsa Stain (Pack of 1000ml) (Merck, KGaA, Germany) (PHLD)

Item: Spirit (PHLD)

UNSPSC: Spirits or liquors

Specifications / Requirementsss:

Spirit (PHLD)

Price Schedule

For Individual Items

# Item Title Quantity Unit Price (PKR) Total Price (PKR) Delivery Location Delivery Period / Year Country of Origin
1
2
For Lots
# Lot Title Total Lot Price (PKR) Country of Origin
1 [Lot 1 Title]

📑 General Conditions of Contract (GCC)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

A. General

1. Definitions

1.1 Unless the context otherwise requires, the following terms whenever used in this Contract shall have the same meaning and shall be interpreted as indicated
  1. “Applicable Law” means the laws and any other instruments having the force of law in the Government’s Country, or in such other country as may be specified in the Special Conditions of the Contract (SC), as they may be issued and in force from time to time;
  2. “Procuring Agency” means:-
    1. any Ministry, Division, Department or any Office of the Government;
    2. any authority, corporation, body or organization established by or under a Law or which is owned or controlled by the Government;.
  3. “The Contract” means an agreement enforceable by law;
  4. “The Contract Price” means the price payable to the Bidder under the Contract for the full and proper performance of its contractual obligations;
  5. “Ancillary Services” means those services ancillary to the provision  of Goods, such as transportation and insurance, and any other incidental services, such as installation, commissioning, provision of technical assistance, training, and other such obligations of the Bidder covered under the  Contract;
  6. “GCC” means the General Conditions of Contract contained in this section;
  7. “SCC” means the Special Conditions of Contract by which the GCC may be amended or supplemented;
  8. Day” means calendar day unless indicated otherwise.
  9. “Effective Date” means the date on which this Contract comes into force and effect.
  10. The Bidder” means the individual or corporate body whose Bids to provide the Goods has been accepted by the Procuring Agency;
  11. “The Project Site,” where applicable, means the place or places named in Bids Data Sheet and technical Specifications;
  12. “Government” means the Government of Pakistan;
  13. “Subcontractor” means any entity to which the Bidder subcontracts any part of the Goods.
  14.  "Service" means any object of procurement other than goods or works;
  15. “Party” means the Procuring Agency or the Bidder, as the case may be, and “Parties” means both of them;
  16. “Foreign Currency” means any currency other than the currency of the country of the Procuring Agency;
  17. “Completion Date” means the date of completion of the contract by the Bidder as certified by the Procuring Agency;
  18.  “In Writing” means communicated in written form with proof of receipt;
  19. “Local Currency” means the currency of Pakistan;

2. Application and Interpretation

2.1 These General Conditions shall apply to the extent that they are not superseded by provisions of other parts of the Contract.

2.2 In interpreting these Conditions of Contract headings and marginal notes are used for convenience only and shall not affect         their interpretations unless specifically stated; references to singular include the plural and vice versa; and masculine include the feminine. Words have their ordinary meaning         under the   language   of   the   Contract   unless specifically defined.

3. Applicable Law

3.1 The contract shall be governed and interpreted in accordance with the laws of Pakistan, unless otherwise specified in SCC.

4. Governing Language

4.1 The Contract as well as all correspondence and documents relating to the Contract exchanged between the Bidder and the Procuring Agency, shall be written in the English language unless otherwise stated in the SCC.  Supporting documents and printed literature that are part of the Contract may be in another language provided these are accompanied by an accurate translation of the relevant passages in English, in which case, for purposes of interpretation of the Contract, this translation shall govern.

5. Notices

5.1 Any notice, request, or consent made pursuant to this Contract shall be in writing and shall be deemed to have been made when delivered in person to an authorized representative of the Party to whom the communication is addressed, or when sent by registered mail, telex, telegram, or facsimile to such Party at the address specified in the SCC.

6. Delivery/Location

6.1 The Goods shall be delivered to such locations as the Procuring Agency may approve and as specified in SCC.

7. Authorized Representatives / Authority of Member in charge

7.1 Any action required or permitted to be taken, and any document required or permitted to be executed, under this Contract by the Procuring Agency or the Bidder may be taken or executed by the officials specified in the SCC.

B. Commencement, Completion, Modification, and Termination of Contract

8. Effectiveness of Contract

8.1 This Contract shall come into effect on the date the Contract is signed by both parties and such other later date as may be stated in the SCC.

9. Commencement of Services

9.1 The Bidder shall confirm availability of Key Experts and begin carrying out the Services not later than the number of days after the Effective Date specified in the SCC.

10. Program

10.1 Before commencement of the Services, the Bidder shall submit to the Procuring Agency for approval a Program showing the general methods, arrangements, order and timing for all activities. The Services shall be carried out in accordance with the approved Program as updated.

11. Starting Date/Expiration Date

11.1 The Bidder shall start carrying out the Services Five (05) days after the date the Contract becomes effective, or at such other date as may be specified in the SCC.

11.2 Unless terminated earlier pursuant to Clause GCC 15 hereof, this Contract shall expire at the end of such time period after the Effective Date as specified in the SCC.

12. Entire Agreement

12.1 This Contract contains all covenants, stipulations and provisions agreed by the Parties.  No agent or representative of either Party has authority to make, and the Parties shall not be bound by or be liable for, any statement, representation, promise or agreement not set forth herein.

13. Modification

13.1 Any modification or variation of the terms and conditions of this Contract, including any modification or variation of the scope of the Services, may only be made by written agreement between the Parties. However, each Party shall give due consideration to any Bids for modification or variation made by the other Party.

13.2 In cases of any modifications or variations, the prior written consent of the Procuring Agency is required.

14. Force Majeure

14.1 Definition

For the purposes of this Contract, “Force Majeure” means an event which is beyond the reasonable control of a Party and which makes a Party’s performance of its obligations under the Contract impossible or so impractical as to be considered impossible under the circumstances.

14.2 No Breach of Contract

The failure of a Party to fulfill any of its obligations under the contract shall not be considered to be a breach of, or default under, this Contract in so far as such inability arises from an event of Force Majeure, provided that the Party affected by such an event (a) has taken all reasonable precautions, due care and reasonable alternative measures in order to carry out the terms and conditions of this Contract, and (b) has informed the other Party as soon as possible about the occurrence of such an event.

14.3 Extension of Time

Any period within which a Party shall, pursuant to this Contract, complete any action or task, shall be extended for a period equal to the time during which such Party was unable to perform such action as a result of Force Majeure.

14.4 Payments

During the period of their inability to perform the Services as a result of an event of Force Majeure, the Bidder shall be entitled to continue to be paid under the terms of this Contract, as well as to be reimbursed for additional costs reasonably and necessarily incurred by them during such period for the purposes of the Services and in reactivating the Service after the end of such period.

15. Termination

15.1 By the Procuring Agency

The Procuring Agency may terminate this Contract in case of the occurrence of any of the events specified in paragraphs (a) through (e) of this Clause. In such an occurrence the Procuring Agency shall give at least thirty (30) calendar days’ written notice of termination to the Bidder in case of the events referred to in (a) through (d); at least sixty (60) calendar days’ written notice in case of the event referred to in (e);

  1. If the Bidder fails to remedy a failure in the performance of its obligations hereunder, as specified in a notice of suspension;
  2. If the Bidder becomes (or, if the Bidder consists of more than one entity, if any of its members becomes) insolvent or bankrupt or enter into any agreements with their creditors for relief of debt or take advantage of any law for the benefit of debtors or go into liquidation or receivership whether compulsory or voluntary;
  3. If the Bidder fails to comply with any final decision reached as a result of arbitration proceedings;
  4. If, as the result of Force Majeure, the Bidder is unable to perform a material portion of the Services for a period of not less than sixty (60) calendar days;
  5. If the Procuring Agency, in its sole discretion and for any reason whatsoever, decides to terminate this Contract;

15.2 By the Bidder

The Bidder may terminate this Contract, by not less than thirty (30) calendar days’ written notice to the Procuring Agency, in case of the occurrence of any of the events specified in paragraphs (a) through (d) of this Clause.

  1. If the Procuring Agency fails to pay any money due to the Bidder pursuant to this Contract and not subject to dispute within forty-five (45) calendar days after receiving written notice from the Bidder  that such payment is overdue.
  2. If, as the result of Force Majeure, the Bidder is unable to perform a material portion of the Services for a period of not less than sixty (60) calendar days.
  3. If the Procuring Agency fails to comply with any final decision reached as a result of arbitration.
  4. If the Procuring Agency is in material breach of its obligations pursuant to this Contract and has not remedied the same within forty-five (45) days (or such longer period as the Bidder may have subsequently approved in writing) following the receipt by the Procuring Agency of the Bidder’s notice specifying such breach.

C.  Obligations of the Bidder

16. General

16.1 Standard of Performance

  1. The Bidder shall deliver the product and carry out the Services with all due diligence, efficiency and economy, in accordance with generally accepted professional standards and practices, and shall observe sound management practices, and employ appropriate technology and safe and effective equipment, machinery, materials and methods. The Bidder shall always act, in respect of any matter relating to this Contract or to the Services, as a faithful adviser to the Procuring Agency, and shall at all times support and safeguard the Procuring Agency’s legitimate interests in any dealings with the third parties.

16.2 Law Applicable to Goods

The Bidder shall deliver the goods in accordance with the Contract and in accordance with the Law of Pakistan and shall take all practicable steps to ensure that any of its Experts and Sub-Bidders, comply with the Applicable Law. 

17. Conflict of Interests

17.1 Bidder Not to Benefit from Commissions and Discounts.

The remuneration of the Bidder shall constitute the Bidder’s sole remuneration in connection with this Contract or the Services, and the Bidder shall not accept for their own benefit any trade commission, discount, or similar payment in connection with activities pursuant to this Contract or to the Services or in the discharge of their obligations under the Contract, and the Bidder shall use their best efforts to ensure that the Personnel, any Subcontractors, and agents of either of them similarly shall not receive any such additional remuneration.

17.2  Bidder and Affiliates Not to be Otherwise Interested in Project

The Bidder agree that, during the term of this Contract and after its termination, the Bidder and its affiliates, as well as any Subcontractor and any of its affiliates, shall be disqualified from providing Goods for any project resulting from or closely related to the Services.

17.3  Prohibition of Conflicting Activities

Neither the Bidder nor its Subcontractors nor the Personnel shall engage, either directly or indirectly, in any of the following activities:

  1. during the term of this Contract, any business or professional activities in the Government’s country which would conflict with the activities assigned to them under this Contract;
  2. during the term of this Contract, neither the Bidder nor their Subcontractors shall hire public employees in active duty or on any type of leave, to perform any activity under this Contract;

18. Confidentiality

18.1 Except with the prior written consent of the Procuring Agency, the Bidder and the Experts shall not at any time communicate to any person or entity any confidential information acquired in the course of the contract.

19. Insurance to be Taken Out by the Bidder

19.1 The Bidder(a) shall take out and maintain, and shall cause any Subcontractors to take out and maintain, at its (or the Subcontractors’, as the case may be) own cost but on terms and conditions approved by the Procuring Agency, insurance against the risks, loss or damage, and for the coverage, as shall be specified in the SCC; and (b) at the Procuring Agency’s request, shall provide evidence to the Procuring Agency showing that such insurance has been taken out and maintained and that the current premiums have been paid.

20. Bidder’s Actions Requiring Procuring Agency’s Prior Approval

20.1 The Bidder shall obtain the Procuring Agency’s prior approval in writing before taking any of the following actions:

(a)    appointing such members of the Personnel not provided by the Bidder;

(b)    changing the Program of activities; and

(c)     any other action that may be specified in the SCC.

21. Reporting Obligations

21.1 The Bidder shall submit to the Procuring Agency the reports and documents in the numbers, and within the periods as prescribed by the Procuring Agency.

22. Liquidated Damages

22.1  If the Supplier fails to deliver any or all of the Goods or to perform the Services within the period(s) specified in the Contract, the Procuring Agency shall, without prejudice to its other remedies under the Contract, deduct from the Contract Price, as liquidated damages, a sum equivalent to the percentage specified in SCC of the delivered price of the delayed Goods or unperformed Services for each week or part thereof of delay until actual delivery or performance, up to a maximum deduction of the performance security (or guarantee) specified in SCC. Once the said maximum is reached, the Procuring Agency may consider termination of the Contract pursuant to GCC Clause 15.

22.2  Correction for Over-payment

If the Intended Completion Date is extended after liquidated damages have been paid, the Procuring Agency shall correct any overpayment of liquidated damages by the Bidder by adjusting the next payment certificate.  The Bidder shall be paid interest on the overpayment, calculated from the date of payment to the date of repayment, at the rates specified in SCC.

22.3  Lack of performance penalty

If the Bidder has not corrected a Defect within the time specified in the Procuring Agency’s notice, a penalty for Lack of performance will be paid by the Bidder. The amount to be paid will be calculated as a percentage of the cost of having the Defect corrected, assessed as specified in the SCC.

23. Performance Guarantee

23.1 Within Seven (07) days from the issuance of acceptance letter from the Procuring Agency, the successful Bidder shall furnish the Performance Guarantee in shape of ------- at the discretion of the PA in the amount specified in SCC. In case the amount of   Bids security is equal or greater than

23.2 The proceeds of the Performance Guarantee shall be payable to the Procuring agency as compensation for any loss resulting from the Supplier’s failure to complete its obligations under the Contract.

23.3 The Performance Guarantee shall be denominated in the currency of the Contract, or in a freely convertible currency acceptable to the Procuring agency and shall be in the acceptable form as specified in SCC.

23.4 The Performance Guarantee will be discharged by the Procuring agency and returned to the Supplier not later than thirty (30) days following the date of completion of the Supplier’s performance obligations under the Contract, including any warranty obligations, unless otherwise specified in SCC.

24. Fraud and Corruption

24.1 The Procuring Agency requires the Supplier to disclose any commissions or fees that may have been paid or are to be paid to agents or any other party with respect to the Bidding process or execution of the Contract. The information disclosed must include at least the name and address of the agent or other party, the amount and currency, and the purpose of the commission, gratuity or fee.

25. Sustainable Procurement

25.1 The Bidder shall conform to the sustainable procurement contractual provisions, if and as specified in the SCC.

D. Bidder’s Personnel

26. Description of Personnel

26.1 The titles, agreed job descriptions, minimum qualifications, and estimated periods of engagement in the carrying out of the Services of the Bidder’s Key Personnel.  The Key Personnel listed by title as well as by name are hereby approved by the Procuring Agency.

27. Removal and/or Replacement of Personnel

27.1 Except as the Procuring Agency may otherwise agree, no changes shall be made in the Key Personnel.  If, for any reason beyond the reasonable control of the Bidder, it becomes necessary to replace any of the Key Personnel, the Bidder shall provide as a replacement a person of equivalent or better qualifications.

27.2 If the Procuring Agency finds that any of the Personnel have (i) committed serious misconduct or have been charged with having committed a criminal action, or (ii) have reasonable cause to be dissatisfied with the performance of any of the Personnel, then the Bidder shall, at the Procuring Agency’s written request specifying the grounds thereof, provide as a replacement a person with qualifications and experience acceptable to the Procuring Agency.

27.3 The Bidder shall have no claim for additional costs arising out of or incidental to any removal and/or replacement of Personnel.

E.  Obligations of the Procuring Agency

28. Assistance and Exemptions

28.1 The Procuring Agency shall use its best efforts to ensure that the Government shall provide the Bidder such assistance and exemptions as specified in the SCC.

29. Change in the Applicable Law

29.1 If, after the date of this Contract, there is any change in the Applicable Law with respect to taxes and duties which increases or decreases the cost of the related Services rendered by the Bidder, then the remuneration and reimbursable expenses otherwise payable to the Bidder under this Contract shall be increased or decreased accordingly by agreement between the Parties, and corresponding adjustments shall be made to the amounts referred in the SCC.

30. Services and Facilities

30.1 The Procuring Agency shall make available to the Bidder and the Experts, for the purposes of the Services and free of any charge, the services, facilities and property described , at the times and in the manner specified in the SCC or terms of reference.

30.2 In case that such services, facilities and property shall not be made available to the Bidder, the Parties shall agree on (i) any time extension that it may be appropriate to grant to the Bidder for the performance of the Services, (ii) the manner in which the Bidder shall procure any such services, facilities and property from other sources, and (iii) the additional payments, if any, to be made to the Bidder as a result thereof.

F. Payments to the Bidder

31. Contract Price

31.1 The price payable shall be in Pakistani Rupees unless otherwise specified in the SCC. Prices charged by the Supplier for Goods delivered under the Contract shall not vary from the prices quoted by the Supplier in its Bid.

32. Terms and Conditions of Payment

32.1 Payments will be made to the Bidder according to the payment schedule stated in the SCC and as per actual invoice submitted by the Bidder.

32.2 Unless otherwise stated in the SCC, the advance payment shall be made against the provision by the Bidder of a bank guarantee for the same amount, and shall be valid for the period stated in the SCC.  Any other payment shall be made after the conditions listed in the SCC for such payment have been met, and the Bidder have submitted an invoice to the Procuring Agency specifying the amount due.

33. Currency of Payment

33.1 Any payment under this Contract shall be made in the currency(ies) specified in the SCC.

G. Quality Control

34. Identifying Defects

34.1 The principle and modalities of Inspection of the Goods by the Procuring Agency shall be as indicated in the SCC. The Procuring Agency shall check the Bidder’s performance and notify him of any Defects that are found.  Such checking shall not affect the Bidder’s responsibilities.  The Procuring Agency may instruct the Bidder to search for a Defect and to uncover and test any service that the Procuring Agency considers may have a Defect. Defect Liability Period is as defined in the SCC.

35. Correction of Defects,and

Lack of Performance Penalty

35.1 The Procuring Agency shall give notice to the Bidder of any Defects before the end of the Contract.  The Defects liability period shall be extended for as long as Defects remain to be corrected.

35.2 Every time notice a Defect is given, the Bidder shall correct the notified Defect within the length of time specified by the Procuring Agency’s notice.

35.3 If the Bidder has not corrected a Defect within the time specified in the Procuring Agency’s notice, the Procuring Agency will assess the cost of having the Defect corrected, the Bidder will pay this amount, and a Penalty for Lack of Performance.

36. Taxes and Duties

36.1 A Supplier shall be entirely responsible for all taxes, duties, fees, etc., incurred until delivery of the contracted Goods to the Procuring Agency.

H. Settlement of Disputes

37. Alternate Dispute Resolution

37.1 The disputes between the parties to the contract may be settled in accordance with Public Procurement Rules, 2004.

37.2 The procuring agency shall refer the matter to the Chief Justice Islamabad High Court or Managing Director PPRA or the Secretary Ministry of Law & Justice for appointment of Arbitrator.

37.3 The fee for the Arbitrator shall be specified in Pak Rupees as determined by the appointing authority which shall be borne and shared equally by the contracting parties.

📑 Special Conditions of Contract (SCC)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

SECTION VIII. SPECIAL CONDITIONS OF CONTRACT

The following Special Conditions of Contract shall supplement the General Conditions of Contract. Whenever there is a conflict, the provisions herein shall prevail over those in the Conditions of Contract. The corresponding clause number of the GCC is indicated in parentheses.

Number of GC Clause

Amendments of, and Supplements to, Clauses in the General Conditions of Contract

Number of GC Clause 1

Definitions

The Procuring Agency is: National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory

The Supplier is:

The title of the subject procurement is: TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Number of GC Clause 3

Applicable/Governing Law:

The Contract shall be interpreted in accordance with the laws of Islamic Republic of Pakistan

Number of GC Clause 4

Language:

The language of the Contract, all correspondence and communications to be given, and all other documentation to be prepared and supplied under the Contract shall be in English.

Number of GC Clause 5

Notices:

The addresses for the notices are:

Procuring Agency: 

National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director
Park Road, Islamabad Capital Territory
+92-333-855-4884
purchaseprocurement58@gmail.com

Contractor/ Bidder: 

 [Name, address and telephone number].

The Contractor/ Bidder’s Representative(s)

[Name, address, telephone number and e-mail address]

Number of GC Clause 7.1

The Authorized Representatives are:

For the Procuring Agency:

National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director
Park Road, Islamabad Capital Territory
+92-333-855-4884
purchaseprocurement58@gmail.com

For the Bidder:

Name: ………………………

Designation: ……………..

Address: ……………………………..

Number of GC Clause 8

Effectiveness of the contract

Number of GC Clause 9

Commencement of Contract:

Number of GC Clause 11.2

Expiration of Contract:

Number of GC Clause 15

Termination

In the event of termination of the contract due to any reason as already defined in the General Conditions of Contract, the Bidder shall be responsible for providing to the Authority the Goods till the time of alternate arrangements.

Number of GC Clause 17

Conflict of Interest:

The Procuring Agency reserves the right to determine on a case-by-case basis whether the Bidder should be disqualified from providing goods or services due to a conflict of a nature described in Clause GCC 17.

Number of GC Clause 22

Liquidated Damages 

If the Bidder fails to provide services as required under the contract or in case of any data loss/data breach or any incident compromising the data security or other such failures related to any services, the Bidder shall pay to the Procuring Agency as Liquidated Damages at a rate of 1.00% to 1.00% of the Contract value, in accordance with the extent of performance failure & the cost of investigating such incidents as judged by the Authority.

Number of GC Clause 23

Performance Guarantee:

The amount of performance guarantee shall be 5.00% of the contract price in acceptable form of Pay Order, Call at Deposit, Demand Draft

Number of GC Clause 32

Payment terms:

Payment will be made to the Bidder against the procured Goods and services according to the actual invoice or running bills submitted by the Bidder against the services provided within the time given in the conditions of the contract.

Number of GC Clause 33

Currency of Payment:

All the payment to be released to the contractor/Bidder shall be in Pakistani Rupees.

Number of GC Clause 34

Identifying Defects:

The Authority reserves the right at any time to inspect the premises of the provider to inspect the goods and monitor the goods being provided.

Number of GC Clause 37

Following is the guidance for Dispute Resolution

  1. If any dispute of any kind whatsoever shall arise between the Authority and the Bidder in connection with or arising out of the Contract, including without prejudice to the generality of foregoing, any question regarding its existence, validity, termination and the execution of the Contract – whether during developing phase or after their completion and whether before or after the termination, abandonment or breach of the Contract – the parties shall seek to resolve any such dispute or difference by mutual diligent negotiations in good faith within 14 (fourteen) days following a notice sent by one Party to the other Party in this regard.
  2. At future of negotiation the dispute shall be resolved through mediation and mediator shall be appointed with the mutual consent of the both parties.
  3. At the event of failure of mediation to resolve the dispute relating to this contract such dispute shall finally be resolved through binding Arbitration by sole arbitrator in accordance with Arbitration Act 1940. The arbitrator shall be appointed by mutual consent of the both parties. The Arbitration shall take place in Islamabad, Pakistan and proceedings will be conducted in English language. 
  4. The cost of the mediation and arbitration shall be shared by the parties in equal proportion however the both parties shall bear their own costs and lawyer’s fees regarding their own participation in the mediation and arbitration. However, the Arbitrator may make an award of costs upon the conclusion of the arbitration making any party to the dispute liable to pay the costs of another party to the dispute.
  5. Arbitration proceedings as mentioned in the above clause regarding resolution of disputes may be commenced prior to, during or after completion of the contract.

Notwithstanding any reference to the arbitration herein, the parties shall continue to perform their respective obligations under the Contract unless they otherwise agree that the Authority shall pay the Bidder any monies due to the Bidder.

Rules of procedure for arbitration proceedings: 

Any dispute between the Authority and a Bidder who is a national of the Islamic Republic of Pakistan arising in connection with the present Contract shall be referred to adjudication or arbitration in accordance with the laws of the Islamic Republic of Pakistan including Arbitration Act 1940, however above provision shall prevail in referring the case to the Arbitrator.

Place of Arbitration and Award:

The arbitration shall be conducted in English language and place of arbitration shall be at Islamabad. The award of the arbitrator shall be final and shall be binding on the parties.

📑 Bid Securing Declaration (BSD)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

Form 9: Bid Securing Declaration

Date: [insert date (as day, month and year)]

Bid No.:P100384

To: National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory

 

 

We, the undersigned, declare that:

We understand that, according to your conditions, Bids must be supported by a Bid Securing Declaration.

We accept that we will be blacklisted and henceforth cross debarred  for participating in respective category of public procurement proceedings for a period of (not more than) six months, if fail to abide with a bid securing declaration, however without indulging in corrupt and fraudulent practices, if we are in breach of our obligation(s) under the Bid conditions, because we:

  1. have  withdrawn  or  modified  our  Bid  during  the  period  of  Bid  Validity specified in the Form of Bid;
  2. Disagreement to arithmetical correction made to the Bid price; or
  3. having been notified of the acceptance of our Bid by the Procuring Agency during the period of Bid Validity, (i) failure to sign the contract if required by Procuring Agency to do so or (ii) fail or refuse to furnish the Performance Security or to comply with any other condition precedent to signing the contract specified in the Bidding Documents.

We understand this Bid Securing Declaration shall expire if we are not the successful

Bidder, upon the earlier of (i) our receipt of your notification to us of the name of the successful Bidder; or (ii) twenty-eight (28) days after the expiration of our Bid.

 

📑 Contract Form (CNF)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

SECTION IX: CONTRACT FORMS

 

THIS AGREEMENT made the _____ day of __________ 20_____ between National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory

 (hereinafter called “the Procuring Agency”) of the one part and [name of Bidder] of [city and country of Bidder] (hereinafter called “the Bidder”) of the other part:

 

WHEREAS the Procuring Agency invited Bids for provision of goods, viz., TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH (P100384) and has accepted a Bids by the Bidder for the provision of Goods in the sum of [contract price in words and figures] (hereinafter called “the Contract Price”).

 

NOW THIS CONTRACT WITNESSETH AS FOLLOWS:

 

1.   In this Contract words and expressions shall have the same meanings as are respectively assigned to them in the Conditions of Contract referred to.

2.   The following documents shall be deemed to form and be read and construed as part of this Contract, In the event of any ambiguity or conflict between the Contract Documents listed below, the order of precedence shall be the order in which the Contract Documents are listed below:-

  1. This form of Contract;
  2. the Form of Bids and the Price Schedule submitted by the Bidder;
  3. the Schedule of Requirements;
  4. the Technical Specifications;
  5. the Special Conditions of Contract;
  6. the General Conditions of the Contract;
  7. the Procuring Agency’s Letter of Acceptance; and
  8. [add here: any other documents]

3.   In consideration of the payments to be made by the Procuring Agency to the Bidder as hereinafter mentioned, the Bidder hereby covenants with the Procuring Agency to provide the Goods related services and to remedy defects therein in conformity in all respects with the provisions of the Contract.

4.   The Procuring Agency hereby covenants to pay the Bidder in consideration of the provision of Goods and the remedying of defects therein, the Contract Price or such other sum as may become payable under the provisions of the contract at the times and in the manner prescribed by the contract.

 

IN WITNESS whereof the parties hereto have caused this Contract to be executed in accordance with their respective laws the day and year first above written.

 

Signed, sealed, delivered by __________________the ________________ (for the Procuring Agency)

 

Witness to the signatures of the Procuring Agency:

………………………………………………

Signed, sealed, delivered by __________________the ________________ (for the Procuring Agency)

 

Witness to the signatures of the Bidder: …………………………………………………

 

 

📑 Integrity Pact (INP)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

Integrity Pact

DECLARATION OF FEES, COMMISSION AND BROKERAGE ETC. PAYABLE BYTHE SUPPLIERS OF GOODS, SERVICES & WORKS IN  CONTRACTS WORTH RS.10.00 MILLION OR MORE

 

Contract                           Number:  Contract                               Value:  Contract Title:

Dated:

 

[Name of Supplier] hereby declares that it has not obtained or induced the procurement of any contract, right, interest, privilege or other obligation or benefit from Government of Pakistan or any administrative subdivision or agency thereof or any other entity owned or controlled by it (GoP) through any corrupt business practice.

Without limiting the generality of the foregoing [Name of Supplier] represents and warrants that it has fully declared the brokerage, commission, fee etc. paid  or payable to anyone and not given or agreed to give and shall not give or agree to give to anyone within or outside Pakistan either directly or indirectly through any natural or juridical person, including its affiliate, agent, associate, broker, consultant, director, promoter, shareholder, sponsor or subsidiary, any commission, gratification, bribe, finder's fee or kickback, whether described as consultations fee or otherwise, with the object of obtaining or inducing the procurement of a contract, right, interest, privilege or other obligation or benefit in whatsoever form from GoP, except that which has been expressly declared pursuant hereto.

[Name of Supplier] certifies that it has made and will make full disclosure of all agreements and arrangements with all persons in respect of or related to the transaction with GoP and has not taken any action or will not take any action to circumvent the above declaration, representative or warranty.

[Name of Supplier] accepts full responsibility and strict liability for making and false declaration, not making full disclosure, misrepresenting fact or taking any action likely to defeat the purpose of this declaration, representation and warranty. It agrees that any contract, right interest, privilege or other obligation or benefit obtained or procured as aforesaid shall, without prejudice to any other right and remedies available to GoP under any law, contract or other instrument, be voidable at the option of GoP.

Notwithstanding any rights and remedies exercised by GoP in this regard, [Name of Supplier] agrees to indemnify GoP for any loss or damage incurred by it on account of its corrupt business practices and further pay compensation to GoP in an amount equivalent to ten time the sum of any commission, gratification, bribe, finder's fee or kickback given by [Name of Supplier] as aforesaid for the purpose of obtaining or inducing the procurement of any contract, right, interest, privilege or other obligation or benefit in whatsoever form from GoP.

📑 Performance Guarantee Form (PGF)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

Performance Guarantee Form

 

To:     National Institutes of Health (NIH) (National Institutes of Health (NIH)), Assistant Director Park Road, Islamabad Capital Territory

 

WHEREAS [name of Bidder] (hereinafter called “the Bidder”) has undertaken, in pursuance of Contract No.  [reference number of the contract] dated [insert date] for provision of Goods(hereinafter called “the Contract”).

 

AND WHEREAS it has been stipulated by you in the said Contract that the Bidder shall furnish you with a Bank Guarantee by a reputable bank for the sum specified therein as security for compliance with the Bidder’s performance obligations in accordance with the Contract.

 

AND WHEREAS we have agreed to give the Bidders guarantee:

 

THEREFORE, WE hereby affirm that we are Guarantors and responsible to you, on behalf of the Bidder, up to a total of [amount of the guarantee in words and figures], and we undertake to pay you, upon your first written demand declaring the Bidder to be in default under the Contract and without cavil or argument, any sum or sums within the limits of [amount of guar­antee] as aforesaid, without your needing to prove or to show grounds or reasons for your demand or the sum specified therein.

 

This guarantee is valid until the: [insert date]

 

 

Signature and seal of the Guarantors

 

 

_____________________________________________________________________

[name of bank or financial institution]

 

 

_____________________________________________________________________

[address]

 

 

_____________________________________________________________________

[date}

📑 Annexure (ANX)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code

Tender Items list and Terms & conditions

Information (Read-Only)

📑 Procurement Forms (PFD)

TENDER FOR SUPPLY OF CHEMICALS/DIAGNOSTIC KITS ETC. FOR NIH

Published on: Friday, September 18, 2026 08:02 PM

Ref# : P100384
QR Code